Festuca stricta

Host · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Festuca

At a glance

Occurrence records2 343

Data sources9

Biological traits16

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Festuca stricta's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 343 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources16 traits

Occurrence & distributionGBIF2 343 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 42

01Narrative

Festuca stricta — вид трав'янистих рослин з родини злакові (Poaceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYLEDAGIFTWCVP

Size & morphology3

Plant height0.13 m

Plant height generative0.5 m

Seed mass0.6 mg

Life cycle & reproduction4

Dispersal typeself

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry2

Photosynthetic pathwayC3

Specific leaf area (SLA)9.86 mm²/mg

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Festuca stricta has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences3

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSEF584972.1 ↗574 bpGermany

ACGT

TCGTGACCCTGACCAAAACAGACCGCGCACGGGTCATCCTGCCTGCCGGGCGGCGGCACCGTCTGTCGCCCAGCCAAAGTCCTCGAAACT …

Festuca stricta internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Festuca stricta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidypolyploid inferred

Chromosome records28–562n range42median42mode11records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 428×CCDB · fl-europaea · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 +1

CCDB · fl-europaea — FelfOldy, 1947

CCDB · ipcn-api-dl — Schreiner, R. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Ausrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.

CCDB · ipcn-api-dl — Tracey, R. H. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.

CCDB · ipcn-api-dl — Smarda. 2005. Ploidy level variability of some central European fescues (Festuca subg.) (Festuca, Poaceae). Biologia (Bratislava) 60(1): 25–36.

CCDB · ipcn-api-dl — Pils, G. 1984. Systematik, Karyologie und Verbreitung der Festuca valesiaca - Gruppe (Poaceae) in Osterreich und Súdtirol. Phyton (Horn) 24: 35–77.

CCDB · book-ipcn73-74 — AUQUIER, P., & J. RAMMELOO. 1973. Nombres chromosomiques dans le genre Festuca en Belgique et dans les regions limitrophes. Bull. Soc. Roy. Bot. Belgique 106: 317-328.

CCDB · kew — Smarda P, Bures P, Horova L, Foggi B, Rossi G. 2008. Genome size and GC content evolution of Festuca: Ancestral expansion and subsequent reduction. Annals of Botany 101: 421-433.

2n 562×CCDB · ipcn-api-dl · CCDB · kew

CCDB · ipcn-api-dl — Pils, G. 1984. Systematik, Karyologie und Verbreitung der Festuca valesiaca - Gruppe (Poaceae) in Osterreich und Súdtirol. Phyton (Horn) 24: 35–77.

CCDB · kew — Smarda P, Bures P, Horova L, Foggi B, Rossi G. 2008. Genome size and GC content evolution of Festuca: Ancestral expansion and subsequent reduction. Annals of Botany 101: 421-433.

2n 281×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Uhrikova, A. & J. Majovksy. 1983. In IOPB chromosome number reports LXXX. Taxon 32: 507.

n 212×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Schreiner, R. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Ausrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.

CCDB · ipcn-api-dl — Tracey, R. H. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 343 records

Wild obs. + sensor818

Museum / vouchered1 522

Other3

Range

Area of Occupancy AOO3 376 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy16% within 1 km

≤100 m 131≤10 km 674

805 georeferenced · 13 without coordinates

Open the mapobservation + sensor818

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 110≤1 km 263≤10 km 1 124>10 km 16

1 513 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence1 522

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Wrocławskilocation not on record	1 490
GJOlocation not on record	13
Wlocation not on record	3
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	3
inatura Erlebnis Naturschau GmbHlocation not on record	2
Provincia di Livornolocation not on record	2
MeiseBGlocation not on record	2
Salzburg, AT	1
Dresden, DE	1
Moscow State Universitylocation not on record	1
Zürich, CH	1
Zürich, CH	1
GZUlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

14 institutions · 1 522 of 1 522 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Festuca stricta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Festuca stricta

At a glance

Sources9 archives

Size & morphology3

Life cycle & reproduction4

Diet & foraging1

Habitat & environment6

Physiology & chemistry2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 343 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 343 records