Festuca rupicaprina

(Hack.) A.Kern. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Festuca

At a glance

Occurrence records1 488

Data sources10

Biological traits22

DNA specimens2

eDNA detections1

Sources10 archives

Databases and archives Festuca rupicaprina's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 488 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources22 traits

Occurrence & distributionGBIF1 488 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT2 Gbp

01Narrative

Festuca rupicaprina là một loài thực vật có hoa trong họ Hòa thảo. Loài này được (Hack.) A.Kern. mô tả khoa học đầu tiên năm 1884.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology6

Plant height0.05 m

Plant height generative0.15 m

Plant height max0.2 m

Plant height min0.1 m

Seed length6.21 mm

Seed mass0.533 mg

Life cycle & reproduction7

Deciduousnessevergreen

Dispersal typewind

Flowering endJul

Flowering startJun

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits2

Diaspore typefruit with appendage

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Festuca rupicaprina has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAF171145.1 ↗611 bpSweden

ACGT

TCGTGACCCTGACCAAAACAGACCGCGCACGCGTCATCCTGCCTGCCGGGCGGCGGCACCGTCTGTCGCCCAGCCAAAGTCCTCGAAACT …

Festuca rupicaprina isolate frup1a internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcLa★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Festuca rupicaprina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 045 242 500 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Festuca rupicaprina2.05 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidy2× diploid · measured

Chromosome records14–142n range14median14mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 145×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Seal, A. G. 1983. DNA variation in Festuca. Heredity 50: 225–236.

CCDB · ipcn-api-dl — Dawe, J. C. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.

CCDB · kew — Smarda P, Bures P, Horova L, Foggi B, Rossi G. 2008. Genome size and GC content evolution of Festuca: Ancestral expansion and subsequent reduction. Annals of Botany 101: 421-433.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 488 records

Wild obs. + sensor1 214

Museum / vouchered233

Other41

Range

Area of Occupancy AOO1 768 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 131≤1 km 282≤10 km 295>10 km 1

709 georeferenced · 505 without coordinates

Open the mapobservation + sensor1 214

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 32≤1 km 39≤10 km 98

169 georeferenced · 64 without coordinates

Open the institutions mapphysical evidence233

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Salzburg, AT	66
GJOlocation not on record	38
BFLlocation not on record	18
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	18
Mlocation not on record	16
Glarus, CH	14
Provincia di Livornolocation not on record	10
LfUlocation not on record	7
Dhaka, BD	7
inatura Erlebnis Naturschau GmbHlocation not on record	6
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	5
Wlocation not on record	5
Bern, CH	4
LDlocation not on record	4
Zürich, CH	3
GZUlocation not on record	2
Dresden, DE	2
Herb. BBGlocation not on record	2
BRNUlocation not on record	1
Zürich, CH	1
Porrentruy, CH	1
University of Salzburglocation not on record	1
Moscow State Universitylocation not on record	1
CJBGlocation not on record	1

24 institutions · 233 of 233 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Festuca rupicaprina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

subalpine calcareous grassland and scrubland…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C 11.9–11.9

Seasonal swing summer↔winter19.4 °C

Max temp (day)16.5 °C

Min temp (night)6.50 °C

Precipitation240 mm/mo

Air humidity64.5 %

Moisture balance125 mm/mo

Vapour deficit497 Pa

Wind speed4.70 m/s

Cloud cover35.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Festuca rupicaprina

At a glance

Sources10 archives

Size & morphology6

Life cycle & reproduction7

Diet & foraging1

Habitat & environment5

Physiology & chemistry1

Other traits2

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 488 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 488 records