Festuca rubra
speciesAt a glance
Occurrence records786 547
Data sources17
Biological traits149
DNA specimens334
eDNA detections541
Sources17 archives
Databases and archives Festuca rubra's data was compiled from.
WikipediaWikimedia Foundation12 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility786 059 records↗
OBISOcean Biodiversity Information System488 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI541 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics334 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources149 traits
Chemical compositionLOTUS · NPASS106 compounds
Occurrence & distributionGBIF · OBIS786 547 records
Environmental DNA4 datasets · 22 countries541 detections
DNA & barcodingBOLD · NCBI334 specimens
Genome at a glanceCCDB · GoaT6.4 Gbp
01Narrative
Der Binsen-Rot-Schwingel (Festuca unifaria, Syn.: Festuca rubra subsp. juncea), auch als Simsen-Rotschwingel bezeichnet, ist ein Süßgras (Poaceae) und gehört zur Rot-Schwingel-Gruppe (Festuca rubra agg.).
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology22
Inflorescence length max15 cm
Inflorescence length min5 cm
Leaf length380 mm
Leaf length max300 mm
Leaf mass24.58 mg
Leaf size237 mm²
⚠ sources differ — TRY: 237 mm² · LEDA: 382 mm² · GIFT: 382 mm²
Leaf width0.9 mm
⚠ sources differ — AusTraits: 0.9 mm · GIFT: 1 mm
Leaf width max2.5 mm
Leaf width min1 mm
Plant height0.431 m
⚠ sources differ — GIFT: 0.431 m · AusTraits: 0.5 m · LEDA: 0.45 m · USDA: 0.61 m · TRY: 0.28 m
Plant height generative0.427 m
Plant height max1 m
Plant height min0.1 m
Seed length3.67 mm
⚠ sources differ — TRY: 3.67 mm · GIFT: 3 mm
Seed length max3 mm
Seed length min3 mm
Seed mass0.968 mg
⚠ sources differ — TRY: 0.968 mg · LEDA: 0.79 mg · GIFT: 6.07 mg
Seed mass max2.82 mg
Seed mass min0.69 mg
Seed volume1.18 mm³
Seed volume max2 mm³
Seed volume min0.66 mm³
Life cycle & reproduction42
After harvest regrowth rateModerate
Bloom periodMid Spring
Coppice potentialNo
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: evergreen
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: anemochorous
Flower colouryellow
Flower conspicuousNo
Flower length max8 mm
Flower length min4.5 mm
Flowering endAug
Flowering startJun
Flowering timennnnnnnnyyyn
Fruit seed period beginSummer
Fruit seed period endSummer
Growth rate USDAModerate
Life formperennial
Life spanperennial
Lifespan categoryLong
Lifespan years400 years
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodYes
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualpresent
Reproductive maturity1 years
Resprout abilityNo
Resprouting capacityresprouts
Seed number244
Seed spread rateSlow
Seedling vigorLow
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateModerate
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment31
Active growth periodSpring and Fall
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max4 400 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureFine
Fruit colourbrown
Fruit fleshinessdry
Fruit typecaryopsis
⚠ sources differ — AusTraits: caryopsis · GIFT: nut
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: herb
Growth form USDARhizomatous
Habitat GIFTforest, meadows: dry, sand
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Leaf shapefiliform
Low growing grassYes
Mycorrhiza typearbuscular
Root depth min12 in
Shape and orientationDecumbent
Small grainNo
Woodinessnon-woody
Physiology & chemistry28
Anaerobic toleranceNone
C:N ratioMedium
Caco3 toleranceHigh
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementMedium
Fire resistantNo
Fire toleranceHigh
Frost free days min90 days
Leaf C:N ratio27.32 g/g
Leaf c441 mg/g
Leaf dry-matter content (LDMC)295 mg/g
⚠ sources differ — TRY: 295 mg/g · LEDA: 273 mg/g
Leaf n17.08 mg/g
Leaf p1.92 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min30 in
Protein potentialLow
Salinity toleranceMedium
Seed longevity index0
Shade toleranceLow
Soil pH max8 pH
Soil pH min5 pH
Specific leaf area (SLA)11.99 mm²/mg
⚠ sources differ — TRY: 11.99 mm²/mg · LEDA: 17.09 mm²/mg · GIFT: 19.36 mm²/mg
Temperature min-43 °F
Wood density277 mg/cm³
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalMedium
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound372 002 per lb
ToxicityNone
Veneer productNo
Other traits9
Diaspore typeone-seeded generative dispersule
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Inflorescencepanicle
Planting density max43 560 per acre
Planting density min43 560 per acre
Shoot orientationerect
03Chemical composition106 compounds
Compounds documented for Festuca rubra across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Ergot alkaloids17
Hydrocarbons9
Branched fatty acids $ Unsaturated fatty acids9
Pyrrolizidine alkaloids9
Unsaturated fatty acids5
Documented compounds106 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-cis-Isopulegone | present | LOTUS | |
| (1R,6S,7S,7aR)-N-methylhexahydro-1H-1,6-epoxypyrrolizin-7-amine | present | LOTUS | |
| (4E)-5-[(1S)-1-hydroxy-2,6,6-trimethyl-4-oxocyclohex-2-en-1-yl]-3-methylpenta-2,4-dienoic acid | present | LOTUS | |
| (8alpha)-9,10-Didehydro-6,8-dimethylergolin-8-ol | present | NPASS | |
| (R)-1-Octen-3-ol | present | LOTUS | |
| 1,2-Dimethylbenzene | present | LOTUS | |
| 1-Hexanol | present | LOTUS | |
| 1-Octanol | present | LOTUS | |
| 12'-Hydroxy-2'-methyl-3',6',18-trioxo-5'alpha-(propan-2-yl)-5alpha-ergotaman | present | LOTUS | |
| 2-Decanone | present | LOTUS |
05DNA & barcoding334 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Festuca rubra has left across the world's sequence archives.
At a glance
DNA specimens334
Marker genes14
GenBank sequences10
eDNA detections541
Countries22
The DNA barcodea real sequence read deposited for this species
CAAACACGCTCCCACCCAACTAAACATGGGGCGGGATGCGGCATGTGGCTCCCCGTCTCGCAAGGGGCGGTGTGCCGAAGATCTGGCTGC …
Festuca rubra isolate CL2021-2024 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL6★rbcLa★trnL★trnL-F★ITS4★ITS1★ITS2atpF-atpHpsbK-psbIrpoBrpoC1trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Festuca rubra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size6 396 120 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Festuca rubra6.4 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 42 n = 21
Ploidypolyploid inferred
Chromosome records14–702n range42median42mode137records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 42103×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · iapt +19
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Hindáková M., 2000: Karyologické štúdium slovenskej flóry XXX. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 40: 23-25.
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · slov-fl — Májovský J., Uhríková A., Javorčíková D., Mičieta K., Králik E., Dúbravcová Z., Feráková V., Murín A., Černušáková D., Hindáková M., Schwarzová T. & Záborský J., 2000: Prvý doplnok karyotaxonomického prehľadu flóry Slovenska. - Acta Fac. Rerum Nat. Univ. Comen., Bot. Supplementum Nr. 1: 1-127.
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · iapt
CCDB · brit-fl — Stace, C.A., Cotton, R. Watsonia 10: 119-138 (1974)
CCDB · brit-fl — Willis, A.J., King, S.M. Bot. Soc. Brit. Isles Proc. 7: 143-149 (1968)
CCDB · brit-fl — McAllister, H.A. (2001)
CCDB · brit-fl — Al-Bermani, A.-K.K.A. (1991)
CCDB · brit-fl — Maude, P.F. New Phytol. 38: 1-31 (1939)
CCDB · brit-fl — Tutin, T.G. Opera Bot. 5: 363-373 (1961)
CCDB · iber-fl — Estudio citotaxonmico de la flora de las costas gallegas Lago Canzobre, E. & S. Castroviejo.Cadernos rea Ci. Biol.3: 1-215(1993).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. I. Gramineae, supl. 2 Queirs, M.Bol. Soc. Brot. ser. 248: 81-98(1974).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4433
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4434
CCDB · fl-europaea — LOve & LOve, 1944
CCDB · fl-europaea — Auquier &
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1971. Studies in chromosome numbers of Polish Angiosperms. Eighth contribution. Acta Biol. Cracov. Ser. Bot. 14, 55-102.
CCDB · poland — Konarska B. 1974. Karyological studies on Festuca rubra L. s.l. from Poland. Acta Biol. Cracov. Ser. Bot. 17, 175-186.
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Stace, C. A. & M. M. Ainscough. 1984. Continuing addition to the gene-pool of the Festuca rubra aggregate (Poaceae: Poeae). Pl. Syst. Evol. 147: 227–236.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1982. Chromosome numbers of some plant species of north-eastern Asia. Bot. Zhurn. SSSR 67 (3): 360–365.
CCDB · ipcn-api-dl — Pashuk, K. T. 1987. Chromosome numbers in species of subalpine belt of Chernogora (Ukrainian Carpatians). Bot. Zhurn. 72: 1069–1074.
CCDB · ipcn-api-dl — Ghorai, A. & A. Sharma. 1981. Chromosome studies in some Festuceae. J. Indian Bot. Soc. 60: 148–153.
CCDB · ipcn-api-dl — Bailey, J. P. & C. A. Stace. 1992. Chromosome banding and pairing behavior in Festuca and Vulpia (Poaceae, Pooideae). Pl. Syst. Evol. 182: 21–28.
CCDB · ipcn-api-dl — Shi, Y., J. Draper & C. Stace. 1993. Ribosomal DNA variation and its phylogenetic implication in the genus Brachypodium (Poaceae). Pl. Syst. Evol. 188: 125–138.
CCDB · ipcn-api-dl — Petrovsky, V. V. & P. G. ZHUKOVA. 1981. Chromosome numbers and taxonomy of some plant species of Wrangel Island. Bot. Zhurn. 66 (3): 380–387.
CCDB · ipcn-api-dl — Frederiksen, S. 1981. Festuca vivipara (Poaceae) in the North Atlantic area. Nordic J. Bot. 1: 277–292.
CCDB · ipcn-api-dl — Jauhar, P. P. 1975a. Genetic regulation of diploid-like chromosome pairing in the hexaploid species Festuca arundinacea Schreb. and F. rubra L. (Gramineae). Chromosoma 52: 363–382.
CCDB · ipcn-api-dl — Seledets. 2005. Ecological area of species: karyological aspects. Pages 95--97 in Karyology, Karyosystematics and Molecular Phylogeny. St. Petersburg, Russia.
CCDB · ipcn-api-dl — Sokolovskaya, A. P., N. S. Probatova & E. G. Rudyka. 1985. Chromosome numbers in the species of the families Asteraceae, Poaceae, Rosaceae from the Primorye Region, Kamchatka and Sakhalin. Bot. Zhurn. SSSR 70(1): 126–128.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1981. Kariologicheskoe issledovanie sosudistykh rastenij ostrovov Dal'nevostocnogo gosudarstvennogo morskogo sapovednika. Sb. Cvetkaye Rastenija Ostrovov Dalnevostochnogo Morskogo Sapovednika. 92–114.
CCDB · ipcn-api-dl — Stace, C. A. 1984. Chromosome numbers of British Plants, 7. Watsonia 15: 38–39.
CCDB · ipcn-api-dl — Seal, A. G. 1983. DNA variation in Festuca. Heredity 50: 225–236.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1983. Chromosome numbers in flowering plants from Greece. Willdenowia 13: 329–333.
CCDB · ipcn-api-dl — Barker, C. M. & C. A. Stace. 1982. Hybridization in the genera Vulpia and Festuca: the production of artificial F;i1 plants. Nordic J. Bot. 2: 435–444.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1981a. In Chromosome number reports LXXI. Taxon 30: 509–511.
+51 more references
2n 5618×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · brit-fl +8
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · brit-fl — McAllister, H. (1992)
CCDB · brit-fl — Al-Bermani, A.-K.K.A. (1991)
CCDB · fl-europaea — Polya, 1949
CCDB · fl-europaea — Kjellqvist, 1964
CCDB · poland — Konarska B. 1974. Karyological studies on Festuca rubra L. s.l. from Poland. Acta Biol. Cracov. Ser. Bot. 17, 175-186.
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1971. Studies in chromosome numbers of Polish Angiosperms. Eighth contribution. Acta Biol. Cracov. Ser. Bot. 14, 55-102.
CCDB · book-ipcn65 — Zhukova 1965b
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Rol poliploidii v genesise flory Putorana. In: L. I. Malyshev, ed. 1976 Flora Putorana: Materali k Poznaniiu Osobennostei Sostava i Genezisia Gornykh Subarkticheskikh Flor Sibir. Novosibirsk. Nauka, Novosibirsk
CCDB · ipcn-api-dl — Barker, C. M. & C. A. Stace. 1982. Hybridization in the genera Vulpia and Festuca: the production of artificial F;i1 plants. Nordic J. Bot. 2: 435–444.
CCDB · ipcn-api-dl — Krahulcová, A. 2003. Chromosome numbers in selected monocotyledons (Czech Republic, Hungary, and Slovakia). Preslia 75: 97–113.
CCDB · book-ipcn73-74 — AUQUIER, P., & J. RAMMELOO. 1973. Nombres chromosomiques dans le genre Festuca en Belgique et dans les regions limitrophes. Bull. Soc. Roy. Bot. Belgique 106: 317-328.
CCDB · book-indian_vol2 — Mehra, P .N. & Sood, O.P. 1976
CCDB · kew — Smarda P, Bures P, Horova L, Foggi B, Rossi G. 2008. Genome size and GC content evolution of Festuca: Ancestral expansion and subsequent reduction. Annals of Botany 101: 421-433.
CCDB · CromoCat 2015 — Guzik, M. B. (1984). Khromosomnye chisla nekotorykh dikorastushchikh zlakov Predural'ja. Ekologija Opylenija Rastenij. Mezhvuzovskij Sbornik Nauchnykh Trudov. Perm. 82-86
CCDB · CromoCat 2015 — Krogulevich, R. E. (1976a). Rol poliploidii v genesise flory Putorana. In: Flora Putorana, NS.
CCDB · CromoCat 2015 — Al-Bermani, A.-K.K.A., Catalan, P. & Stace, C.A. (1992). A new circumscription of Festuca trichophylla (Gaudin) K. Richter (Gramineae). Anales Jard. Bot. Madrid 50:209-220
2n 149×CCDB · iapt · CCDB · iber-fl · CCDB · fl-europaea +4
CCDB · iapt
CCDB · iber-fl — Contribuiao para o conhecimento cariolgico das halfitas e psamfitas litorais. 142-162. Coimbra. Mesquita Rodrigues, J. E.*(1953).
CCDB · fl-europaea — Rodrigues, 1953
CCDB · ipcn-api-dl — Stefanik, V. I., N. K. Yakimchuk & V. I. Vainagij. 1989. Karyologicheskaya kharakteristika nekotorykh vidov semejstva Poaceae Ukrainskikh Karpat. Pp. 37--39 in Tesizy II Symp. Plant Karyology.
CCDB · ipcn-api-dl — Tateoka, T. 1980a. Notes on Festuca hondoensis (Poaceae). Mem. Natl. Sci. Mus. (Tokyo) 13: 149–154.
CCDB · book-ipcn73-74 — MEHRA, P.N., & P. REMANANDAN. 1973. Cytological investigations on W.l Himalayan Pooideae. Cytologia 38: 237-258.
CCDB · book-atlas-flowering-plants
CCDB · CromoCat 2015 — Mesquita Rodrigues, J. E. (1953). Contribuiçao para o conhecimento cariológico das halófilas e psamófitas litorais. Diss. Univ. Coimbra 1-210
CCDB · CromoCat 2015 — Stefanik, V. I., N. K. Yakimchuk & V. I. Vainagij (1989). Karyologicheskaya kharakteristika nekotorykh vidov semejstva Poaceae Ukrainskikh Karpat. Pp. 37--39 in Tesizy II Symp. Plant Karyology
2n 285×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · CCDB · book-indian_vol2 +2
CCDB · ipcn-api-dl — Uhrikova, A., V. Ferakova & T. SCHWARZOVA. 1983. In IOPB chromosome number reports LXXX. Taxon 32: 507–508.
CCDB · book-ipcn73-74 — KOZUHAROV, S.I., & A.V. PETROVA. 1973. In IOPB chromosome number reports XL. Taxon 22: 28~-291.
CCDB · book-indian_vol2 — Kozuharov, S.I. & Petrova, A.V. 1973
CCDB · CromoCat 2015 — Petrova, A. & S. Kozuharov. (1987). Citotaxonomicno proucvane na balgarski vidove ot roda Festuca L. V: Trudova IV. nacionalna Conferencia po botanika 1: 16-23.
CCDB · Automatic manuscript search — D. Kopeck,J. Barto,Z. Zwierzykowski and J. Doleel. 2009. "Chromosome pairing of individual genomes in tall fescue (Festuca arundinacea Schreb.), its progenitors, and hybrids with Italian ryegrass (Lolium multiflorum Lam.)". Cytogenetic and Genome Research 124:170-178.
2n 494×CCDB · poland · CCDB · book-ipcn66 · CCDB · CromoCat 2015
CCDB · poland — Konarska B. 1974. Karyological studies on Festuca rubra L. s.l. from Poland. Acta Biol. Cracov. Ser. Bot. 17, 175-186.
CCDB · book-ipcn66 — Love & LOve 1966b
CCDB · CromoCat 2015 — Ghorai, A. & Sharma, A. (1981). Chromosome studies in some Festuceae Journal of the Indian Botanical Society 60: 148-153
CCDB · CromoCat 2015 — Salvesen, P. H. (1986). Festuca vivipara in southern Norway, infraspecific differentiation and systematic affinities. Symbolae Botanicae Upsaliensis 27: 155-167
2n 634×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · CromoCat 2015
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Al-Bermani, A.-K.K.A. (1991)
CCDB · CromoCat 2015 — Ghorai, A. & Sharma, A. (1981). Chromosome studies in some Festuceae Journal of the Indian Botanical Society 60: 148-153
CCDB · CromoCat 2015 — Salvesen, P. H. (1986). Festuca vivipara in southern Norway, infraspecific differentiation and systematic affinities. Symbolae Botanicae Upsaliensis 27: 155-167
2n 413×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · Original-count
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Al-Bermani, A.-K.K.A. (1991)
CCDB · Original-count — Winterfeld, G., Röser, M. (2007). Chromosomal localization and evolution of satellite DNAs and heterochromatin in grasses (Poaceae), especially tribe Aveneae. Pl. Syst. Evol. 264: 75–100. doi: 10.1007/s00606-006-0482-27
2n 351×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Salvesen, P. H. (1986). Festuca vivipara in southern Norway, infraspecific differentiation and systematic affinities. Symbolae Botanicae Upsaliensis 27: 155-167
2n 441×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Tateoka, T. (1980). Notes on Festuca hondoensis (Poaceae). Memoirs of the National Science Museum, Tokyo 13: 149-154.
2n 701×GoaT · DTOL Flowering Plants Estimates Kew
GoaT · DTOL Flowering Plants Estimates Kew
n 217×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 +3
CCDB · ipcn-api-dl — Dubé, M., J. Murdock. & P. Morisset. 1985. Races chromosomiques chez Festuca rubra sensu lato (Poaceae) dans l'est du Québec. Canad. J. Bot. 63: 227–231.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn75-78 — Reeder 1977
CCDB · book-ipcn73-74 — AUQUIER, P., & J. RAMMELOO. 1973. Nombres chromosomiques dans le genre Festuca en Belgique et dans les regions limitrophes. Bull. Soc. Roy. Bot. Belgique 106: 317-328.
CCDB · book-ipcn73-74 — POJAR, J. 1973. Levels of polyploidy in four vegetation types of southwestern British Columbia. Canad. J. Bot. 51: 621-628. I
CCDB · CromoCat 2015 — Dubé, M., Morisset, P. & Murdock, J. (1985). Races chromosomiques chez Festuca rubra sensu lato (Poaceae) dans l'est du Québec. Canadian Journal of Botany 63: 227-231
CCDB · iapt — IAPT/IOPB Chromosome Data 29
n 286×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · CromoCat 2015 +1
CCDB · ipcn-api-dl — Dubé, M., J. Murdock. & P. Morisset. 1985. Races chromosomiques chez Festuca rubra sensu lato (Poaceae) dans l'est du Québec. Canad. J. Bot. 63: 227–231.
CCDB · ipcn-api-dl — Mehra, P. N. 1982. Cytology of East Indian grasses. ý.
CCDB · ipcn-api-dl — Parkash, O. 1979. Cytological investigations in some grasses of northeastern India (Festucoids, Ischaemum Linn., Eulalia Kunth and Saccharum spontaneum Linn.). Ph.D. Thesis, Chandigarh. 1979.
CCDB · book-ipcn75-78 — Mehra & Sood 1976
CCDB · CromoCat 2015 — Dubé, M., Morisset, P. & Murdock, J. (1985). Races chromosomiques chez Festuca rubra sensu lato (Poaceae) dans l'est du Québec. Canadian Journal of Botany 63: 227-231
CCDB · iapt — IAPT/IOPB Chromosome Data 33
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Provontova, N. S & Kazanovsky, S .G & Rudyka, E.G & Barkalov, V.Y & Seledets, V.P & Nechaev, V.A (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1790-1794
n 131×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 25
n 141×CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — MEHRA, P.N., & P. REMANANDAN. 1973. Cytological investigations on W.l Himalayan Pooideae. Cytologia 38: 237-258.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
08Occurrence & distribution
Record type786 547 records
Wild obs. + sensor733 044
Museum / vouchered49 190
Cultivated / captive1 185
Other3 128
Origin
Native11 865
Introduced335
Range
Area of Occupancy AOO611 984 km²
Depth
0–200 m sunlit1
200–1000 m twilight0
1–4 km midnight0
>4 km abyssal0
median 3 m · max 3 m · 1 record with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy66% within 1 km
≤100 m 228 070≤1 km 135 958≤10 km 187 243>10 km 3 085
554 356 georeferenced · 178 688 without coordinates
Open the mapobservation + sensor733 044
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy42% within 1 km
≤100 m 4 338≤1 km 11 775≤10 km 20 948>10 km 957
38 018 georeferenced · 11 172 without coordinates
Open the institutions mapphysical evidence49 190
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy84% within 1 km
≤1 km 419≤10 km 61>10 km 19
499 georeferenced · 686 without coordinates
Open the mapnot free-living1 185
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions222 of 420 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 26 970 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 1 941 |
| Moscow State Universitylocation not on record | 1 293 |
| Olocation not on record | 1 067 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 736 |
| LDlocation not on record | 657 |
| Salzburg, AT | 587 |
| Uppsala, SE | 491 |
| TROMlocation not on record | 412 |
| Tartu, EE | 394 |
| SWE054location not on record | 382 |
| Christchurch, NZ | 377 |
| Bergen, NO | 354 |
| SLU Artdatabankenlocation not on record | 321 |
| Trondheim, NO | 313 |
| Québec, CA | 297 |
| Oulu, FI | 286 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 284 |
| MeiseBGlocation not on record | 282 |
| WTUlocation not on record | 275 |
| Garðabær, IS | 275 |
| DBF-NHMDlocation not on record | 245 |
| Université Lavallocation not on record | 227 |
| Beijing, CN | 202 |
| Adam Mickiewicz University in Poznańlocation not on record | 198 |
| Tallinn, EE | 195 |
| Victoria, CA | 184 |
| Vancouver, CA | 179 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 169 |
| 160 | |
| University of Stellenboschlocation not on record | 152 |
| Acadia Universitylocation not on record | 144 |
| BRNUlocation not on record | 139 |
| Oskarshamn, SE | 136 |
| Corvallis, US | 133 |
| Odawara, JP | 119 |
| Irkutsk State Universitylocation not on record | 116 |
| Uniwersytet Warszawskilocation not on record | 114 |
| Logan, US | 106 |
| University of Alberta Museumslocation not on record | 106 |
| Sanda, JP | 102 |
| Claremont, US | 100 |
| Davis, US | 100 |
| BDBClocation not on record | 98 |
| South Kensington, GB | 94 |
| Kandalaksha State Nature Reservelocation not on record | 91 |
| KMNlocation not on record | 89 |
| Bronx, US | 88 |
| Montréal, CA | 82 |
| BFLlocation not on record | 73 |
| Chongqing Museumlocation not on record | 71 |
| Philadelphia, US | 71 |
| Canberra, AU | 69 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 68 |
| Wlocation not on record | 68 |
| POL003location not on record | 68 |
| Museo Entomologico de Leonlocation not on record | 67 |
| Barcelona, ES | 63 |
| Jyväskylä, FI | 63 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 62 |
| Saint John, CA | 61 |
| BClocation not on record | 61 |
| Chiba, JP | 59 |
| Entomological Society of Latvialocation not on record | 59 |
| GMBAlocation not on record | 57 |
| Helsinki, FI | 57 |
| Provincia di Livornolocation not on record | 54 |
| Saint Louis, US | 53 |
| Mlocation not on record | 53 |
| Ann Arbor, US | 52 |
| Chengdu, CN | 52 |
| New Haven, US | 52 |
| Moscow, US | 52 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 51 |
| Burlington, US | 51 |
| Angwin, US | 51 |
| BIO-UNIPIlocation not on record | 50 |
| Kew, GB | 49 |
| Anchorage, US | 47 |
| Madison, US | 46 |
| St. Paul, US | 45 |
| Missoula, US | 45 |
| Bloomington, US | 42 |
| Xining, CN | 42 |
| Görlitz, DE | 40 |
| MAlocation not on record | 40 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 40 |
| Arcata, US | 40 |
| Riverside, US | 39 |
| Turku, FI | 39 |
| HUN003location not on record | 36 |
| Tomioka, JP | 35 |
| Zürich, CH | 34 |
| Toronto, CA | 33 |
| Hobart, AU | 31 |
| Vitoria, ES | 30 |
| Frankfurt am Main | 29 |
| UGentlocation not on record | 29 |
| Kuopio, FI | 29 |
| Zürich, CH | 27 |
| San Luis Obispo, US | 27 |
| Auckland, NZ | 27 |
| Mount Annan, AU | 27 |
| Glarus, CH | 26 |
| WNNUlocation not on record | 26 |
| DMZ botanic gardenlocation not on record | 25 |
| International Salmonella Centre (W.H.O.)location not on record | 25 |
| Porvoo, FI | 25 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 24 |
| Dresden, DE | 24 |
| Yangling, CN | 24 |
| GBR016location not on record | 24 |
| Berlin, DE | 24 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 23 |
| IWEP FEB RASlocation not on record | 23 |
| Denver, US | 23 |
| València, ES | 22 |
| Allentown, US | 22 |
| CJBGlocation not on record | 21 |
| College Park, US | 21 |
| ROM003location not on record | 21 |
| Paris, FR | 21 |
| Flagstaff, US | 20 |
| Bourges, FR | 20 |
| Taipei, TW | 20 |
| Williamsburg, US | 20 |
| GJOlocation not on record | 19 |
| Kushiro City Museumlocation not on record | 19 |
| Uniwersytet Jagiellońskilocation not on record | 19 |
| Tampa, US | 19 |
| CICYTEXlocation not on record | 18 |
| Uniwersytet Śląski w Katowicachlocation not on record | 18 |
| Boise, US | 18 |
| Pacific Lutheran Universitylocation not on record | 18 |
| Adelaide, AU | 18 |
| Provo, US | 17 |
| PRClocation not on record | 17 |
| Museo Achille Folettolocation not on record | 16 |
| Santa Barbara, US | 16 |
| Parthenon Tama History Museumlocation not on record | 16 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 15 |
| Canadian Department of Agriculturelocation not on record | 15 |
| Wuzhou, CN | 15 |
| Green Bay, US | 14 |
| SZUlocation not on record | 14 |
| San Diego, US | 14 |
| ASUlocation not on record | 13 |
| Tromso University Museumlocation not on record | 13 |
| CASlocation not on record | 13 |
| Bozeman, US | 13 |
| WINlocation not on record | 13 |
| Uniwersytet Opolskilocation not on record | 13 |
| Torreón, MX | 13 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 13 |
| Trois-Rivières, CA | 12 |
| Tacoma, US | 12 |
| Pamplona, ES | 11 |
| ROM007location not on record | 11 |
| Lanzhou, CN | 11 |
| SWlocation not on record | 11 |
| KR | 11 |
| Rotorua, NZ | 11 |
| TUR-Alocation not on record | 11 |
| Rovaniemi, FI | 11 |
| Bend, US | 10 |
| Lausanne, CH | 10 |
| Albuquerque, US | 10 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 10 |
| Honolulu, US | 10 |
| Seoul, KR | 10 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 10 |
| Porrentruy, CH | 10 |
| Guangzhou, CN | 10 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 10 |
| Pullman, US | 10 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 9 |
| AASlocation not on record | 9 |
| Montecillo, Texcoco, MX | 9 |
| Bando, JP | 9 |
| Nijmegen, NL | 9 |
| nlocation not on record | 9 |
| Philadelphia, US | 9 |
| Whitehorse, CA | 9 |
| Yukon Universitylocation not on record | 9 |
| Natural History Museum Rotterdamlocation not on record | 9 |
| GB | 9 |
| Naturalis Biodiversity Centerlocation not on record | 9 |
| Kunming, CN | 8 |
| San Jose, US | 8 |
| ESP119location not on record | 8 |
| Stockholm, SE | 8 |
| Obihiro Centennial City Museumlocation not on record | 8 |
| Norfolk, US | 8 |
| Chengdu, CN | 7 |
| Austin, US | 7 |
| nbflocation not on record | 7 |
| Pittsburg, US | 7 |
| GZUlocation not on record | 7 |
| Nagatoro-machi, Chichibu-gun, JP | 7 |
| Taipei, TW | 7 |
| Montréal, CA | 7 |
| Bern, CH | 7 |
| Rocky Mountain Biological Laboratorylocation not on record | 6 |
| Chapel Hill, US | 6 |
| Institute of the biological problems of the North FEB RASlocation not on record | 6 |
| Tilburg, NL | 6 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 6 |
| Badajoz, ES | 6 |
| Karlsruhe, DE | 6 |
| Knoxville, US | 6 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 6 |
| Salamanca, ES | 6 |
| Santa Cruz, US | 6 |
| BISHlocation not on record | 6 |
| Wuhan, CN | 6 |
| Cheney, US | 6 |
| Yunnan Universitylocation not on record | 6 |
| Staten Island, US | 6 |
| TAIElocation not on record | 5 |
| Portland, US | 5 |
| Alicante, ES | 5 |
| Korea National Arboretumlocation not on record | 5 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 5 |
| Brisbane, AU | 5 |
| Xiamen, CN | 5 |
| HJAEFlocation not on record | 5 |
| College of the Atlantic, Museumlocation not on record | 5 |
| Urumqi, CN | 5 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 5 |
| Stockholm, SE | 5 |
| Caldwell, US | 5 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 5 |
| Boumlocation not on record | 5 |
| University of Winnipeglocation not on record | 5 |
| CZE082location not on record | 5 |
| Guasave, MX | 5 |
| Ciudad Autónoma de Buenos Aires, AR | 5 |
| SVN019location not on record | 5 |
| Mississippi State, US | 5 |
| EL PASO, US | 5 |
| Brussel, BE | 5 |
| Madrid, ES | 4 |
| Fredericton Stock Culture Collectionlocation not on record | 4 |
| Istituto Agrario Castelnuovolocation not on record | 4 |
| Awka, NG | 4 |
| Podgorica, ME | 4 |
| Johnson City, US | 4 |
| Wellington, NZ | 4 |
| NMBU:MINAlocation not on record | 4 |
| New Brunswick, US | 4 |
| BGR001location not on record | 4 |
| Mexico City, MX | 4 |
| Pocatello, US | 4 |
| Royal British Columbia Museumlocation not on record | 4 |
| Pretoria, ZA | 4 |
| Phoenix, US | 4 |
| San Angelo, US | 4 |
| DOI/NPS, Greenbelt Parklocation not on record | 4 |
| National Museum Waleslocation not on record | 4 |
| Durango, MX | 4 |
| Dekalb, US | 4 |
| Kingston, US | 3 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 3 |
| Urumqi, CN | 3 |
| BSBIlocation not on record | 3 |
| Fort Bragg, US | 3 |
| ENTClocation not on record | 3 |
| John T. Waterhouse Herbariumlocation not on record | 3 |
| Kensington, AU | 3 |
| Grand Junction, US | 3 |
| Otaru, JP | 3 |
| Research Collection of Christian Lettnerlocation not on record | 3 |
| Göteborg, SE | 3 |
| Winterthur, CH | 3 |
| Sagamihara, JP | 3 |
| Maryland Department of Natural Resourceslocation not on record | 3 |
| Durham, US | 3 |
| OLAlocation not on record | 3 |
| Forssa, FI | 3 |
| Columbia, US | 3 |
| University of Lethbridgelocation not on record | 3 |
| New Mexico State Universitylocation not on record | 3 |
| Armidale, AU | 3 |
| Kyoto Universitylocation not on record | 3 |
| Servico de Microbiologia e Imunologialocation not on record | 3 |
| Research Collection of Siegrun Ertllocation not on record | 3 |
| Kiritappu Wetland National Trustlocation not on record | 3 |
| Davenport, US | 3 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 3 |
| Chicago, US | 3 |
| Pamplona, ES | 3 |
| San Isidro, AR | 3 |
| Ashland, US | 3 |
| Bureau of Land Management, Medford District Officelocation not on record | 3 |
| Henderson, US | 3 |
| University of Tennessee at Chattanoogalocation not on record | 3 |
| Copenhagen, DK | 3 |
| Oswego, US | 3 |
| Osaka, JP | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Edinburgh, GB | 2 |
| IRL001location not on record | 2 |
| Palmerston North, NZ | 2 |
| Irvine, US | 2 |
| San Diego Natural History Museumlocation not on record | 2 |
| San Diego Natural History Museum, Herbariumlocation not on record | 2 |
| Durango, US | 2 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 2 |
| National Biodiversity Institute, Costa Ricalocation not on record | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| Akita Prefectural Museumlocation not on record | 2 |
| McWane Science Centerlocation not on record | 2 |
| BAYLUlocation not on record | 2 |
| Philadelphia, US | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 2 |
| Lord Fairfax Community Collegelocation not on record | 2 |
| Herbario Universidad de Concepciónlocation not on record | 2 |
| Coimbra, PT | 2 |
| Metsähallituslocation not on record | 2 |
| Truckee, US | 2 |
| Clemson, US | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Mexico City, MX | 2 |
| Beijing, CN | 2 |
| Jiangxi College of Educationlocation not on record | 2 |
| USFSlocation not on record | 2 |
| Stephenville, US | 2 |
| VALElocation not on record | 2 |
| Beijing Normal Universitylocation not on record | 2 |
| Parkville, AU | 2 |
| Salvador, BR | 2 |
| Keene State Universitylocation not on record | 2 |
| Millersville, US | 2 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 2 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 2 |
| China Agricultural Universitylocation not on record | 1 |
| ZRC-SAZUlocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Sion, CH | 1 |
| Texas A&M Universitylocation not on record | 1 |
| US | 1 |
| Ypsilanti, US | 1 |
| US | 1 |
| STNFlocation not on record | 1 |
| Orem, US | 1 |
| FLADlocation not on record | 1 |
| University of Manitoba Herbariumlocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| San José, CR | 1 |
| Taipei, TW | 1 |
| AUAlocation not on record | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| ISAlocation not on record | 1 |
| The University of Arizonalocation not on record | 1 |
| Granada, ES | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Kochi, JP | 1 |
| UChlocation not on record | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| Hangzhou, CN | 1 |
| 东北师范大学自然博物馆location not on record | 1 |
| Gijón, ES | 1 |
| Cape Town, ZA | 1 |
| Edmonton, CA | 1 |
| Xian, CN | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Shanxi Institute of Biologylocation not on record | 1 |
| Chicago, US | 1 |
| University of Hulllocation not on record | 1 |
| Fort Worth, US | 1 |
| CIIDIRlocation not on record | 1 |
| US | 1 |
| San Luis Potosí, MX | 1 |
| Due West, US | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| NoColllocation not on record | 1 |
| München, DE | 1 |
| Nanjing, CN | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Toyota city nature sanctuarylocation not on record | 1 |
| B.A. Bennett Herbariumlocation not on record | 1 |
| Universität Göttingenlocation not on record | 1 |
| Umeå Universitylocation not on record | 1 |
| Bothell, US | 1 |
| ROM023location not on record | 1 |
| GAlocation not on record | 1 |
| GINRlocation not on record | 1 |
| PrivatHerblocation not on record | 1 |
| Chicago, US | 1 |
| BG-NMNHSlocation not on record | 1 |
| Hamilton, US | 1 |
| H-Meierottlocation not on record | 1 |
| Portland, US | 1 |
| Los Angeles, US | 1 |
| Northridge, US | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Sevilla, ES | 1 |
| State University of New York, College at Oneontalocation not on record | 1 |
| Centre for Biodiversity Genomicslocation not on record | 1 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 1 |
| LUXEMBOURG, LU | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| Canadian Museum of Naturelocation not on record | 1 |
| IDElocation not on record | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| State Herbarium of South Australialocation not on record | 1 |
| Namur, BE | 1 |
| Siberian Federal Universitylocation not on record | 1 |
| Brookings, US | 1 |
| Citadel Hill, GB | 1 |
| DASSHlocation not on record | 1 |
| QVMAGlocation not on record | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| Palmerston, AU | 1 |
| Dhaka, BD | 1 |
| SVK001location not on record | 1 |
| Fayetteville, US | 1 |
| KURAlocation not on record | 1 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 1 |
420 institutions · 46 444 of 49 190 vouchered records shown · 1 934 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA541 detections
Where the DNA of Festuca rubra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found541
Studies independent surveys4
Countries22
Verifiable raw sequence linked5
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 541 detections have coordinates
Open the map22 countries0
Tidal saltmarsh with Juncus gerardii, Atripl…Riparian/Coastal Sage Scrub with Platanus ra…exposed beachUpland edgeIn limestone fieldPines; Bromus sitchensis, Elymus glaucus, F.…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Measured at samplingin-field
Temperature18.3 °C -1.50–30.2
pH8.10 6.79–8.71
Conductivity47,211 µS/cm 28,000–57,440
Salinity35.3 PSU 16.9–38.7
Dissolved oxygen7.52 mg/L 1.99–11.1
Turbidity0.39 NTU 0–8.38
Nitrate0.925 µmol/L 0.064–12.6
Depth3.00 m 0–5,281
Coastal waterPelagicSedimentCoral
384 samples with on-site data · median with range · describes the sample, not the organism
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.2 °C 10.9–21.9
Seasonal swing summer↔winter8.10 °C
Max temp (day)18.7 °C 12.4–24.1
Min temp (night)14.1 °C 7.40–20.2
Precipitation74.1 mm/mo 24.3–124
Air humidity58.8 % 56.0–62.7
Vapour deficit784 Pa 499–1,094
Cloud cover26.4 % 14.2–50.9
CHELSA 1981–2010, ~9 km grid, at location & month of 498 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.