Festuca psammophila

(Hack. ex Čelak.) Fritsch · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Festuca

At a glance

Occurrence records1 291

Data sources8

Biological traits24

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Festuca psammophila's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 291 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources24 traits

Occurrence & distributionGBIF1 291 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 14

01Narrative

Festuca psammophila is a species of grass which is endemic to Central Europe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology4

Leaf mass44.77 mg

Leaf size142 mm²

Plant height0.225 m

⚠ sources differ — GIFT: 0.225 m · LEDA: 0.225 m · TRY: 0.6 m

Plant height generative0.45 m

Life cycle & reproduction8

Deciduousnessaestival

Dispersal typeanimal

Life formperennial

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formhemicryptophyte

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry4

Leaf dry-matter content (LDMC)549 mg/g

Photosynthetic pathwayC3

Seed longevity index0

Specific leaf area (SLA)3.25 mm²/mg

Other traits1

Diaspore typefruit with appendage

05DNA & barcoding8 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Festuca psammophila has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences8

Countries1

The DNA barcodea real sequence read deposited for this species

matKLR588335.1 ↗2 785 bpGermany · 2014

ACGT

ACATTTGGATGGAGCAACAAATTCGTCCAGACTCTTGGTAGAGTCTAGAAGACCACGACTGATCCTCAAGGGTAATGAATGGAAAAAATA …

Festuca psammophila tRNA-Lys (trnK) gene and intron, partial sequence; maturase K (matK) gene, complete cds; psbA gene, partial sequence, isolate DB19186

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK8

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Festuca psammophila carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 145×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71

CCDB · ipcn-api-dl — Alexeev, E. B., A. P. Sokolovskaya & N. S. Probatova. 1988. Taxonomy, distribution and chromosome numbers of fescues (Festuca L., Poaceae) in the flora of the USSR. 3. The section Festuca: F. tschujensis--F. beckeri. Bjull. Moskovsk. Obač. Isp. Prir., Otd. Biol. 93: 90–99.

CCDB · ipcn-api-dl — Smarda. 2005. Ploidy level variability of some central European fescues (Festuca subg.) (Festuca, Poaceae). Biologia (Bratislava) 60(1): 25–36.

CCDB · ipcn-api-dl — `marda, P. & K. Kočí. 2003. Chromosome number variability in Central European members of the Festuca ovina and F. pallens groups (sect. Festuca). Folia Geobot. 38(1): 65–95.

CCDB · book-ipcn67-71 — SCHWARZOVA, T. 1967. Beitrag zur LBsung taxonomischer Probleme der Festuca vaginata W.K. und Festuca psammophilla Hack. Acta Fae. Rerum Nat. Univ. Comenianae. Bot. 14: 381-412.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 291 records

Wild obs. + sensor722

Museum / vouchered546

Other23

Range

Area of Occupancy AOO2 476 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy5% within 1 km

≤100 m 28≤1 km 5≤10 km 649

682 georeferenced · 40 without coordinates

Open the mapobservation + sensor722

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 4≤1 km 123≤10 km 333

460 georeferenced · 86 without coordinates

Open the institutions mapphysical evidence546

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Wrocławskilocation not on record	456
Adam Mickiewicz University in Poznańlocation not on record	37
Berlin, DE	13
Frankfurt am Main	8
Görlitz, DE	7
Uniwersytet Jagiellońskilocation not on record	5
Dresden, DE	4
BRNUlocation not on record	2
Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record	1
Uniwersytet Warszawskilocation not on record	1
Wlocation not on record	1
South Kensington, GB	1

12 institutions · 536 of 546 vouchered records shown · 8 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Festuca psammophila

At a glance

Sources8 archives

Size & morphology4

Life cycle & reproduction8

Diet & foraging1

Habitat & environment6

Physiology & chemistry4

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 291 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 12 geolocated

Record type1 291 records