Festuca picturata

Pils · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Festuca

At a glance

Occurrence records2 637

Data sources11

Biological traits16

DNA specimens3

eDNA detections1

Sources11 archives

Databases and archives Festuca picturata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 637 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF2 637 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT2.8 Gbp

01Narrative

Festuca picturata is a species of grass which can be found in Central, Eastern and southeastern Europe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height0.4 m

Plant height max0.4 m

Plant height min0.2 m

Seed mass0.664 mg

Life cycle & reproduction5

Flowering endAug

Flowering startJul

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Festuca picturata has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences3

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKY368827.1 ↗596 bpAustria

ACGT

TCGTGACCCTGACCAAAACAGACCGCGCACGCGTCATCCTGCCTGTCGGGCGGCGGCATCGTTCATCGCCCGGCCAAAGTCCTCGAAAAC …

Festuca picturata voucher Schonswetter & Katharina, UZ 11.08 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★trnL★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Festuca picturata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 840 601 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Festuca picturata2.84 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidy2× diploid · measured

Chromosome records14–142n range14median14mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 148×GoaT · Kew Plant DNA C-values Database · CCDB · fl-europaea · CCDB · ipcn-api-dl +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · fl-europaea — Majovsky et al.,

CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Pashchuk, K. T. 1983. Ekologo-citologicheskie issledovanija flory v ekosistemakh subal'pijskogo pojasa Chernogory. Tezisy Dokl. 7 Delegat. S"ezda Vsesojusn. Bot. Ob. Doneck. 28.

CCDB · ipcn-api-dl — Pashuk, K. T. 1987. Chromosome numbers in species of subalpine belt of Chernogora (Ukrainian Carpatians). Bot. Zhurn. 72: 1069–1074.

CCDB · ipcn-api-dl — Stefanik, V. I., N. K. Yakimchuk & V. I. Vainagij. 1989. Karyologicheskaya kharakteristika nekotorykh vidov semejstva Poaceae Ukrainskikh Karpat. Pp. 37--39 in Tesizy II Symp. Plant Karyology.

CCDB · ipcn-api-dl — Pils, G. 1980. Systematics, distribution and karyology of the Festuca violacea group (Poaceae) in the Eastern Alps. Pl. Syst. Evol. 136: 73–124.

CCDB · kew — Smarda P, Bures P, Horova L, Foggi B, Rossi G. 2008. Genome size and GC content evolution of Festuca: Ancestral expansion and subsequent reduction. Annals of Botany 101: 421-433.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 637 records

Wild obs. + sensor980

Museum / vouchered471

Other1 186

Range

Area of Occupancy AOO1 716 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 372≤1 km 61≤10 km 87

520 georeferenced · 460 without coordinates

Open the mapobservation + sensor980

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 38≤1 km 150≤10 km 266

454 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence471

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Wrocławskilocation not on record	312
Salzburg, AT	104
GJOlocation not on record	22
GZUlocation not on record	5
Moscow State Universitylocation not on record	4
BRNUlocation not on record	4
Wlocation not on record	4
Provincia di Livornolocation not on record	3
SZUlocation not on record	3
PRClocation not on record	3
Dresden, DE	2
Frankfurt am Main	2
University of Salzburglocation not on record	1
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	1

14 institutions · 470 of 471 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Festuca picturata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

south-exposed rich alpine meadows

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 11.2–11.2

Seasonal swing summer↔winter19.5 °C

Max temp (day)15.6 °C

Min temp (night)6.10 °C

Precipitation185 mm/mo

Air humidity63.8 %

Moisture balance72.8 mm/mo

Vapour deficit483 Pa

Wind speed4.80 m/s

Cloud cover35.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Festuca picturata

At a glance

Sources11 archives

Size & morphology4

Life cycle & reproduction5

Diet & foraging1

Habitat & environment5

Other traits1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type2 637 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 637 records