Festuca ovina
speciesAt a glance
Occurrence records256 026
Data sources12
Biological traits131
DNA specimens48
eDNA detections31
Sources12 archives
Databases and archives Festuca ovina's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility256 026 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics48 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources131 traits
Chemical compositionLOTUS28 compounds
Occurrence & distributionGBIF256 026 records
Environmental DNA1 datasets · 7 countries31 detections
DNA & barcodingBOLD · NCBI48 specimens
Genome at a glanceCCDB · GoaT4.6 Gbp
01Narrative
Festuca ovina, la Fétuque ovine ou Fétuque des moutons, est une espèce de plantes herbacées vivaces de la famille des Poaceae, sous-famille des Pooideae, tribu des Aveneae cultivée essentiellement pour l'établissement de pelouses et rarement, comme plante fourragère.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYWCVP
Size & morphology16
Leaf length max60 mm
Leaf mass2.3 mg
Leaf size36.02 mm²
⚠ sources differ — TRY: 36.02 mm² · LEDA: 24.52 mm² · GIFT: 25.9 mm²
Plant height0.201 m
⚠ sources differ — GIFT: 0.201 m · LEDA: 0.152 m · USDA: 0.152 m · TRY: 0.294 m
Plant height generative0.274 m
Plant height max0.65 m
Plant height min0.05 m
Seed length4.24 mm
⚠ sources differ — TRY: 4.24 mm · GIFT: 3 mm
Seed length max3 mm
Seed length min3 mm
Seed mass0.71 mg
⚠ sources differ — TRY: 0.71 mg · LEDA: 0.38 mg · GIFT: 8.5 mg
Seed mass max1.29 mg
Seed mass min0.13 mg
Seed volume0.3 mm³
Seed volume max0.3 mm³
Seed volume min0.3 mm³
Life cycle & reproduction35
After harvest regrowth rateModerate
Bloom periodLate Spring
Coppice potentialNo
Deciduousnessevergreen
⚠ sources differ — TRY: evergreen · GIFT: deciduous
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: anemochorous
Flower colouryellow
Flower conspicuousNo
Flowering endJun
Flowering startMay
Fruit seed period beginSummer
Fruit seed period endSummer
Growth rate USDAModerate
Life formperennial
Life spanperennial
Lifespan categoryLong
Lifespan years3 years
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Resprout abilityNo
Seed number68.5
Seed spread rateModerate
Seedling vigorMedium
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment30
Active growth periodSpring
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max4 400 m
Elevation mean3 300 m
Elevation min2 200 m
Epiphyteterrestrial
Foliage colorGray-Green
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureFine
Fruit colourbrown
Fruit fleshinessdry
Growth formherb
Growth form USDABunch
Habitat GIFTforest, meadows
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min10 in
Shape and orientationSemi-Erect
Small grainNo
Woodinessnon-woody
Physiology & chemistry28
Anaerobic toleranceNone
C:N ratioMedium
Caco3 toleranceNone
Cold stratification requiredNo
Drought toleranceHigh
Fertility requirementMedium
Fire resistantNo
Fire toleranceMedium
Frost free days min90 days
Leaf C:N ratio31.38 g/g
Leaf c442 mg/g
Leaf dry-matter content (LDMC)380 mg/g
⚠ sources differ — TRY: 380 mg/g · LEDA: 300 mg/g
Leaf n14.23 mg/g
Leaf p1.1 mg/g
Moisture useLow
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max30 in
Precipitation min12 in
Protein potentialLow
Salinity toleranceLow
Seed longevity index0
Shade toleranceMedium
Soil pH max7.5 pH
Soil pH min5.5 pH
Specific leaf area (SLA)17.96 mm²/mg
⚠ sources differ — TRY: 17.96 mm²/mg · LEDA: 14.13 mm²/mg · GIFT: 14.8 mm²/mg
Temperature min-43 °F
Wood density118 mg/cm³
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalMedium
Palatable graze animalMedium
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound530 320 per lb
ToxicityNone
Veneer productNo
Other traits5
Diaspore typegenerative dispersule
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
03Chemical composition28 compounds
Compounds documented for Festuca ovina across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Pyrrolizidine alkaloids5
Simple phenolic acids3
Purine alkaloids3
Cinnamic acids and derivatives3
Carboline alkaloids2
Documented compounds28 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (5R)-5-hydroxytritriacontane-12,14-dione | present | LOTUS | |
| 4-((R)-((2S,4R,5R)-5-Vinyl-1-azabicyclo(2.2.2)octane-2-yl)hydroxymethyl)-6-methoxyquinoline | present | LOTUS | |
| 4-Hydroxybenzoic acid | present | LOTUS | |
| 6-(3,4-Dimethoxyphenyl)benzo[f][2,7]naphthyridin-4-one | present | LOTUS | |
| Berberine | present | LOTUS | |
| Brucine | present | LOTUS | |
| Caffeine | present | LOTUS | |
| cis 4-Hydroxyproline | present | LOTUS | |
| Ephedrine | present | LOTUS | |
| Ergotamine | present | LOTUS |
05DNA & barcoding48 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Festuca ovina has left across the world's sequence archives.
At a glance
DNA specimens48
Marker genes6
GenBank sequences10
eDNA detections31
Countries8
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTTCTGGCCGAGGGCACGCCTGCCTGGGCGTCACGCCAA …
Festuca ovina voucher EDNA21-0061198 internal transcribed spacer region, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL2★rbcLa★ITS5★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Festuca ovina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size4 586 820 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Festuca ovina4.59 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records14–702n range14median14mode105records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1460×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +15
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — BIDAULT M. - 1966. Observations caryologiques sur le Festuca ovina L. ssp. laevis Hack.. Bull. Soc. Bot. France , 113(1/2): 1/12/2014.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Uhríková A. & Dúbravcová Z., 1997: The chromosome numbers of some selected plant species of flora in Slovakia. - Oecologia Montana 6/1-2: 1-3.
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · iapt
CCDB · brit-fl — McAllister, H. (1993)
CCDB · brit-fl — Wilkinson, M.J. (1986)
CCDB · brit-fl — Wilkinson, M.J., Stace, C.A. Bot. J. Linn. Soc. 106: 347-397 (1991)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4442
CCDB · fl-europaea — LoVe & Lbve, 1956
CCDB · poland — Mizianty M. and Pawlus M. 1982. Chromosome numbers of some Polish species from the genus Festuca group Ovina (part I). Fragm. Flor. Geobot. 28, 363-369.
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Yurtsev, B. A. & P. G. ZHUKOVA. 1982. Chromosome numbers of some plants of the northeastern Yakutia (the drainage of the Indigirka River in its middle reaches). Bot. Zhurn. 67 (6): 778–787. (In Russian).
CCDB · ipcn-api-dl — Mizianty, M. & M. Pawlus. 1982. Chromosome numbers of some Polish species from the genus Festuca, group Ovina (Part I). Fragm. Florist. Geobot. 28: 363–369.
CCDB · ipcn-api-dl — Borgen, L. & R. Elven. 1983. Chromosome numbers of flowering plants from northern Norway and Svalbard. Nord. J. Bot. 3: 301–306.
CCDB · ipcn-api-dl — Dawe, J. C. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
CCDB · ipcn-api-dl — Frederiksen, S. 1981. Festuca vivipara (Poaceae) in the North Atlantic area. Nordic J. Bot. 1: 277–292.
CCDB · ipcn-api-dl — Guldahl, A. S., L. Borgen & I. Nordal. 2001. Variation in the Festuca brachyphylla (Poaceae) complex in Svalbard, elucidated by chromosome numbers and isozymes. Bot. J. Linn. Soc. 137(2): 107–126.
CCDB · ipcn-api-dl — Gukasyan. 2003. On the cytogenetic study of the grasses (Poaceae) of Armenia. Page 303 in Botanical Study in Asiatic Russia. Vol. 1. Barnaul.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1981. Kariologicheskoe issledovanie sosudistykh rastenij ostrovov Dal'nevostocnogo gosudarstvennogo morskogo sapovednika. Sb. Cvetkaye Rastenija Ostrovov Dalnevostochnogo Morskogo Sapovednika. 92–114.
CCDB · ipcn-api-dl — Salvesen, P. H. 1986. Festuca vivipara in southern Norway, infraspecific differentiation and systematic affinities. Symb. Bot. Upsal. 27: 155–167.
CCDB · ipcn-api-dl — Alexeev, E. B., A. P. Sokolovskaya & N. S. Probatova. 1990. Taxonomy, distribution and chromosome numbers of festucues (Festuca L., Poaceae) in the USSR flora, 4. Section Festuca: F. ovana--F. filiformis. Bjull. Moskovsk. Obač. Isp. Prir., Otd. Biol. 95: 71–78.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1980. A karyotaxonomic study of the grasses of the Altai Mts. Bot. Zhurn. 65 (4): 509–520.
CCDB · ipcn-api-dl — Engelskjon, T. 1979. Chromosome numbers in vascular plants from Norway, including Svalbard. Opera Bot. 52: 1–38.
CCDB · ipcn-api-dl — Rodionov, A.V., E. O. Punina, M. A. Dobroradova, N. B. Tyupa & N. N. Nosov. 2006. Caryological study of the grasses (Poaceae): chromosome numbers of some Aveneae, Poeae, Phalarideae, Phleeae, Bromeae, Triticeae. Bot. Žhurn. (Moscow & Leningrad) 91(4): 615–627.
CCDB · ipcn-api-dl — Sokolovskaya, A. P. & N. S. Probatova. 1979. Chromosome numbers of some grasses (Poaceae) in the U.S.S.R. flora. III. Bot. Zhurn. 64 (9): 1245–1258.
CCDB · ipcn-api-dl — Probatova, N. S., A. P. Sokolovskaya & E. G. Rudyka. 1989. Chromosome numbers in some species of vascular plants from Kunashir Island (the Kuril Islands). Bot. Žhurn. (Moscow & Leningrad) 74: 1675–1678.
CCDB · book-ipcn67-71 — GADELLA, Th. W.J., & E. KLIPHUIS. 1968. Chromosome numbers of flowering plants in the Netherlands IV. Proc. Roy. Netherlands Acad. Sci. ser. C. 71: 168-183.
CCDB · book-ipcn67-71 — KNABEN, G., & T. ENGELSKJON. 1967. Chromosome numbers of Scandinavian arctic-alpine plant species. II. Act. Boreal. A. Sci. No. 21: 1-57.
CCDB · book-ipcn67-71 — TATEOKA, T. 1967. In IOPB chromosome number reports XIV. Taxon 16: 552-571.
CCDB · book-ipcn75-78 — Alexeev 197 4
CCDB · book-ipcn75-78 — Probatova & Sokolovskaya 1978
CCDB · book-ipcn75-78 — Sokolovskaya & Probatova 1976a
CCDB · book-ipcn73-74 — GADELLA, T.W.J., & E. KLIPHUIS. 1973. Chromosome numbers of flowerinl plants in the Netherlands VI. Proc. Kon. Ned. Acad. Wet., ser. C 76: 303-311.
CCDB · book-ipcn73-74 — MALIK, C.P., & R.C. TRIPATHI. 1973. Cytological studies in the genus Festuca. Chromosome Inf. Serv. 15: 25-27.
CCDB · book-indian_vol2 — Church, G.L. 1936 ; Gustafsson, A. 1947b ; Brandberg, B. . 1948 ; Litardibre, R. de 1950; Love, A. & Love, D. 1956b ; Sokolovskaya, A.P. (Fedorov) ; Liptak ova, G. 1963 ; Holmen, K. 1964; Knaben, G. & EngelskjOn, T. 1967 ; Gadella, T.W.J. & Kliphuis, E. 1968a; Alekseev, E.B. 1974
CCDB · book-atlas-flowering-plants — Litardiere 1950
+15 more references
2n 2830×CCDB · iapt · CCDB · brit-fl · CCDB · nw-europe-fl +8
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · brit-fl — Wilkinson, M.J. (1986)
CCDB · brit-fl — Jenkin, T.J. J. Genet. 53: 118-124 (1955)
CCDB · brit-fl — Wilkinson, M.J., Stace, C.A. Watsonia 16: 303-309 (1987)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4440
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4441
CCDB · poland — Skali?ska M. et al. 1950. Studies in chromosome numbers of Polish Angiosperms. Acta Soc. Bot. Pol. 20, 45-68.
CCDB · ipcn-api-dl — Malakhova, L. A. & G. A. Markova. 1994. Chromosome numbers in the flowering plants of Tomsk region. Monocotyledones. Bot. Žhurn. (Moscow & Leningrad) 79(7): 134–135.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — `marda, P. & K. Kočí. 2003. Chromosome number variability in Central European members of the Festuca ovina and F. pallens groups (sect. Festuca). Folia Geobot. 38(1): 65–95.
CCDB · ipcn-api-dl — Alexeev, E. B., A. P. Sokolovskaya & N. S. Probatova. 1990. Taxonomy, distribution and chromosome numbers of festucues (Festuca L., Poaceae) in the USSR flora, 4. Section Festuca: F. ovana--F. filiformis. Bjull. Moskovsk. Obač. Isp. Prir., Otd. Biol. 95: 71–78.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1980. A karyotaxonomic study of the grasses of the Altai Mts. Bot. Zhurn. 65 (4): 509–520.
CCDB · ipcn-api-dl — Schreiner, R. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Ausrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
CCDB · ipcn-api-dl — Tracey, R. H. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
CCDB · ipcn-api-dl — Hand, R. & T. Gregor. 2011. Chromosomenzahlen von Farn- und Samenpflanzen aus Deutschland 5. Kochia 5: 33–38.
CCDB · ipcn-api-dl — Smarda. 2005. Ploidy level variability of some central European fescues (Festuca subg.) (Festuca, Poaceae). Biologia (Bratislava) 60(1): 25–36.
CCDB · book-ipcn66 — Malik & Thomas 1966b
CCDB · book-ipcn67-71 — GADELLA, T.W.J., & E. KLIPHUIS. 1971. Chromosome numbers of flowering plants in the Netherlands v. Proc. Kon. Ned. Acad. Wetensch. ser C 74:
CCDB · book-ipcn75-78 — Belaeva & Siplivinsky 1976
CCDB · book-ipcn75-78 — Auquier 1977
CCDB · book-ipcn73-74 — AUQUIER, P., & J. RAMMELOO. 1973. Nombres chromosomiques dans le genre Festuca en Belgique et dans les regions limitrophes. Bull. Soc. Roy. Bot. Belgique 106: 317-328.
CCDB · book-indian_vol2 — Nakajima, G. 1931 ; Gadella, T.W.J. & Klipbuis, E. 1971a ; Auquier, P. & Rammeloo, J. 1973
CCDB · iapt — IAPT/IOPB Chromosome Data 17
CCDB · CromoCat 2015 — Malakhova, L. A. & Markova, G. A. (1994). Chromosome numbers in the flowering plants of Tomsk region. Monocotyledones Bot. Žurn. 79(7): 134-135
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Lubogoschinsky, P. I., Isaikina, M. M. & Fleckenstein, K. M. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:891-892
CCDB · CromoCat 2015 — Albers, F. & Pröbsting, W. (1998). In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart
CCDB · CromoCat 2015 — Chepinoga, V.V., Gnutikov, A. A., Enuschenko, I. V. & Rosbakh, S. A. (2009). IAPT/IOPB Chromosome Data 8 Taxon 58 (4): 1281-1282
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A. & Rosbakh, S. A. (2010). IAPT/IOPB Chromosome Data 9 Taxon 59 (4): 1298-1299
2n 4210×CCDB · iapt · CCDB · iber-fl · CCDB · book-ipcn65 +4
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · iber-fl — Mediterranean chromosome number reports. 394-400 Ortez Rubio, E. & V. de la Fuente Garca.Fl. Mediterranea5: 261-265(1995).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. I. Gramineae, supl. 2 Queirs, M.Bol. Soc. Brot. ser. 248: 81-98(1974).
CCDB · book-ipcn65 — Hil 1965
CCDB · ipcn-api-dl — Love, A. & D. Love. 1981a. In Chromosome number reports LXXI. Taxon 30: 509–511.
CCDB · ipcn-api-dl — Ortunez Rubio, E. & V. d. Garcia. 1995. Mediterranean chromosome number reports 5 (394--400). Fl. Medit. 5: 261–265.
CCDB · ipcn-api-dl — de la Fuente, V., L. M. Ferrero & E. Ortúñez. 2001. Chromosome counts in the genus Festuca L. section Festuca (Poaceae) in the Iberian Peninsula. Bot. J. Linn. Soc. 137(4): 385–398.
CCDB · book-ipcn75-78 — Queiros 1974
CCDB · book-indian_vol2 — Miintzing, A. 1937b ; Hill, H.D. 1965 ; Mehra, P.N. & Sharma, M.L. I975c
CCDB · CromoCat 2015 — Queirós, M. (1974a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. I. Gramineae, supl. 2. Bol. Soc. Brot. 48: 81-98.
2n 704×GoaT · Kew Plant DNA C-values Database · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 +1
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · book-ipcn67-71 — BIDAULT, M. 1967. Etude biosystematique de quelques formes critiques de Festuca ovina L. subsp. sulcata Hack. Bull. Soc. Bot. France-Tfli": 47-58.
CCDB · book-ipcn73-74 — MALIK, C.P., & R.C. TRIPATHI. 1973. Cytological studies in the genus Festuca. Chromosome Inf. Serv. 15: 25-27.
CCDB · kew — Smarda P, Bures P, Horova L, Foggi B, Rossi G. 2008. Genome size and GC content evolution of Festuca: Ancestral expansion and subsequent reduction. Annals of Botany 101: 421-433.
2n 351×CCDB · poland
CCDB · poland — Skali?ska M. et al. 1950. Studies in chromosome numbers of Polish Angiosperms. Acta Soc. Bot. Pol. 20, 45-68.
2n 491×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — BIDAULT, M. 1967. Etude biosystematique de quelques formes critiques de Festuca ovina L. subsp. sulcata Hack. Bull. Soc. Bot. France-Tfli": 47-58.
2n 561×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — BIDAULT, M. 1967. Etude biosystematique de quelques formes critiques de Festuca ovina L. subsp. sulcata Hack. Bull. Soc. Bot. France-Tfli": 47-58.
n 143×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74
CCDB · ipcn-api-dl — Schreiner, R. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Ausrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
CCDB · ipcn-api-dl — Tracey, R. H. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
CCDB · book-ipcn73-74 — AUQUIER, P., & J. RAMMELOO. 1973. Nombres chromosomiques dans le genre Festuca en Belgique et dans les regions limitrophes. Bull. Soc. Roy. Bot. Belgique 106: 317-328.
n 213×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78
CCDB · ipcn-api-dl — de la Fuente, V., L. M. Ferrero & E. Ortúñez. 2001. Chromosome counts in the genus Festuca L. section Festuca (Poaceae) in the Iberian Peninsula. Bot. J. Linn. Soc. 137(4): 385–398.
CCDB · book-ipcn67-71 — KUPFER, P. 1968. Nouvelles prospections caryologiques dans le flore orophile des Pyrenees et de la Sierra Nevada. Bull. soc. Neuchateloise Sci. Nat. 91: 87-10~.
CCDB · book-ipcn75-78 — Mehra & Sharma 1975b
n 02×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Probatova, N.S.& Kazanovsky, S.G.& Rudyka, E.G. & Seledets, V.P. & Nechaev,V.A (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:899-902
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Lubogoschinsky, P. I., Isaikina, M. M. & Fleckenstein, K. M. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:891-892
n 281×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — KUPFER, P. 1968. Nouvelles prospections caryologiques dans le flore orophile des Pyrenees et de la Sierra Nevada. Bull. soc. Neuchateloise Sci. Nat. 91: 87-10~.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type256 026 records
Wild obs. + sensor226 019
Museum / vouchered28 930
Cultivated / captive184
Other893
Origin
Native10 341
Introduced27
Range
Area of Occupancy AOO375 116 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy74% within 1 km
≤100 m 96 122≤1 km 57 075≤10 km 54 055>10 km 909
208 161 georeferenced · 17 858 without coordinates
Open the mapobservation + sensor226 019
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy32% within 1 km
≤100 m 1 886≤1 km 5 373≤10 km 14 295>10 km 1 398
22 952 georeferenced · 5 978 without coordinates
Open the institutions mapphysical evidence28 930
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy73% within 1 km
≤1 km 32≤10 km 1>10 km 11
44 georeferenced · 140 without coordinates
Open the mapnot free-living184
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions158 of 309 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 17 007 |
| Moscow State Universitylocation not on record | 1 132 |
| Helsinki, FI | 812 |
| LDlocation not on record | 529 |
| Beijing, CN | 429 |
| BFLlocation not on record | 429 |
| Uppsala, SE | 411 |
| Irkutsk State Universitylocation not on record | 374 |
| Olocation not on record | 363 |
| TROMlocation not on record | 276 |
| Tartu, EE | 250 |
| Trondheim, NO | 236 |
| SLU Artdatabankenlocation not on record | 223 |
| BDBClocation not on record | 216 |
| Oulu, FI | 199 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 189 |
| Salzburg, AT | 171 |
| Adam Mickiewicz University in Poznańlocation not on record | 153 |
| Chengdu, CN | 150 |
| Turku, FI | 147 |
| BRNUlocation not on record | 147 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 137 |
| Oskarshamn, SE | 130 |
| Bergen, NO | 129 |
| MeiseBGlocation not on record | 123 |
| Bronx, US | 107 |
| Logan, US | 91 |
| Görlitz, DE | 82 |
| KMNlocation not on record | 78 |
| Chengdu, CN | 77 |
| Uniwersytet Warszawskilocation not on record | 76 |
| DBF-NHMDlocation not on record | 72 |
| Barcelona, ES | 71 |
| Kandalaksha State Nature Reservelocation not on record | 71 |
| Moscow, US | 68 |
| Philadelphia, US | 58 |
| Saint Louis, US | 56 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 54 |
| KR | 54 |
| Tallinn, EE | 54 |
| Toyama, JP | 52 |
| Odawara, JP | 51 |
| Bern, CH | 49 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 48 |
| Jyväskylä, FI | 47 |
| BClocation not on record | 44 |
| Xining, CN | 44 |
| New Haven, US | 43 |
| Nagano City, JP | 43 |
| Taipei, TW | 42 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 39 |
| Sanda, JP | 38 |
| GBR016location not on record | 38 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 34 |
| SWE054location not on record | 34 |
| Kuopio, FI | 33 |
| Guangzhou, CN | 32 |
| J.F.Oberlin Universitylocation not on record | 32 |
| South Kensington, GB | 32 |
| University of Stellenboschlocation not on record | 32 |
| Taipei, TW | 31 |
| Tomioka, JP | 31 |
| TAIElocation not on record | 30 |
| Wlocation not on record | 29 |
| Riverside, US | 29 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 28 |
| Mlocation not on record | 27 |
| MAlocation not on record | 27 |
| Kyoto Universitylocation not on record | 24 |
| WTUlocation not on record | 24 |
| Provincia di Livornolocation not on record | 24 |
| Yangling, CN | 23 |
| CJBGlocation not on record | 22 |
| BIO-UNIPIlocation not on record | 22 |
| Pamplona, ES | 22 |
| PRClocation not on record | 22 |
| Urumqi, CN | 21 |
| Dresden, DE | 21 |
| Zürich, CH | 20 |
| National Institute of Biological Resourceslocation not on record | 20 |
| Stockholm, SE | 20 |
| ASUlocation not on record | 20 |
| Flagstaff, US | 20 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 18 |
| Seoul, KR | 18 |
| nlocation not on record | 17 |
| Nagatoro-machi, Chichibu-gun, JP | 17 |
| Kunming, CN | 17 |
| Bloomington, US | 16 |
| Allentown, US | 16 |
| Zürich, CH | 15 |
| Berlin, DE | 15 |
| Tampa, US | 15 |
| ENTClocation not on record | 15 |
| Burlington, US | 15 |
| Uniwersytet Śląski w Katowicachlocation not on record | 15 |
| Entomological Society of Latvialocation not on record | 14 |
| Weber State Universitylocation not on record | 14 |
| Provo, US | 13 |
| Bourges, FR | 13 |
| Tsukuba, JP | 13 |
| Xian, CN | 13 |
| Podgorica, ME | 13 |
| UGentlocation not on record | 13 |
| Uniwersytet Jagiellońskilocation not on record | 12 |
| Vitoria, ES | 12 |
| Kushiro City Museumlocation not on record | 12 |
| SWlocation not on record | 12 |
| ESP119location not on record | 12 |
| TUR-Alocation not on record | 12 |
| Lanzhou, CN | 12 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 11 |
| WNNUlocation not on record | 11 |
| DMZ botanic gardenlocation not on record | 11 |
| International Salmonella Centre (W.H.O.)location not on record | 11 |
| Porrentruy, CH | 11 |
| Bando, JP | 10 |
| Christchurch, NZ | 10 |
| Nijmegen, NL | 10 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 10 |
| Taipei, TW | 10 |
| Iwate Prefectural Museumlocation not on record | 10 |
| Dekalb, US | 10 |
| Porvoo, FI | 9 |
| Mississippi State, US | 9 |
| Elocation not on record | 8 |
| Vancouver, CA | 8 |
| University of Alberta Museumslocation not on record | 8 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 8 |
| Museo Entomologico de Leonlocation not on record | 8 |
| Auckland, NZ | 8 |
| Servico de Microbiologia e Imunologialocation not on record | 8 |
| Yunnan Universitylocation not on record | 7 |
| Frankfurt am Main | 7 |
| Garðabær, IS | 7 |
| University of Winnipeglocation not on record | 7 |
| JP | 7 |
| Boise, US | 7 |
| Wuhan, CN | 7 |
| Kew, GB | 7 |
| Pamplona, ES | 7 |
| Zhengzhou, CN | 6 |
| H-Diewaldlocation not on record | 6 |
| Canberra, AU | 6 |
| Madrid, ES | 6 |
| Philadelphia, US | 6 |
| Obihiro Centennial City Museumlocation not on record | 6 |
| Denver, US | 6 |
| SABGlocation not on record | 6 |
| Nanjing, CN | 6 |
| Chiba, JP | 6 |
| KOMlocation not on record | 6 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 6 |
| Claremont, US | 6 |
| València, ES | 6 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 6 |
| Paris, FR | 6 |
| nbflocation not on record | 5 |
| Natural History Museum Rotterdamlocation not on record | 5 |
| Davenport, US | 5 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 5 |
| GZUlocation not on record | 5 |
| Tromso University Museumlocation not on record | 5 |
| Jiangxi College of Educationlocation not on record | 5 |
| Tacoma, US | 5 |
| Staten Island, US | 5 |
| Rovaniemi, FI | 5 |
| LfUlocation not on record | 5 |
| Inner Mongolia Universitylocation not on record | 5 |
| Sendai, JP | 5 |
| Québec, CA | 5 |
| CICYTEXlocation not on record | 5 |
| Pocatello, US | 5 |
| College of the Atlantic, Museumlocation not on record | 5 |
| Hobart, AU | 4 |
| Korea National Arboretumlocation not on record | 4 |
| Phoenix, US | 4 |
| Urumqi, CN | 4 |
| Missoula, US | 4 |
| Akita Prefectural Museumlocation not on record | 4 |
| GJOlocation not on record | 4 |
| Victoria, CA | 3 |
| Ivano-Frankove, UA | 3 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 3 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 3 |
| Xiamen, CN | 3 |
| Acadia Universitylocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Université Lavallocation not on record | 3 |
| Osaka, JP | 3 |
| Lubbock, US | 3 |
| Bozeman, US | 3 |
| Karlsruhe, DE | 3 |
| National Museum Waleslocation not on record | 3 |
| BSBIlocation not on record | 3 |
| University of New Hampshirelocation not on record | 3 |
| Göteborg, SE | 3 |
| Beijing Normal Universitylocation not on record | 3 |
| Chongqing Museumlocation not on record | 3 |
| PrivatHerblocation not on record | 3 |
| Boumlocation not on record | 2 |
| Guangzhou, CN | 2 |
| Albuquerque, US | 2 |
| KNAMlocation not on record | 2 |
| Bandelier National Monumentlocation not on record | 2 |
| San Angelo, US | 2 |
| China Agricultural Universitylocation not on record | 2 |
| Chapel Hill, US | 2 |
| Musée des Confluenceslocation not on record | 2 |
| Sant Julià de Lòria, AD | 2 |
| Forssa, FI | 2 |
| DNSMlocation not on record | 2 |
| Tianjin Natural History Museumlocation not on record | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| Durango, US | 2 |
| Oswego, US | 2 |
| San Diego, US | 2 |
| Nanchong, CN | 2 |
| EL PASO, US | 2 |
| IWEP FEB RASlocation not on record | 2 |
| Winterthur, CH | 2 |
| College Park, US | 2 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 2 |
| Salvador, BR | 2 |
| Wuzhou, CN | 2 |
| NMWlocation not on record | 2 |
| BGR001location not on record | 2 |
| 2 | |
| AASlocation not on record | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Chicago, US | 2 |
| Ensenada, MX | 2 |
| Williamsburg, US | 2 |
| Mexico City, MX | 2 |
| Philadelphia, US | 2 |
| H-AkrKGlocation not on record | 2 |
| SVN019location not on record | 2 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 2 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 2 |
| Awka, NG | 2 |
| QAUlocation not on record | 2 |
| Mohonk Preservelocation not on record | 2 |
| Pittsburg, US | 2 |
| Keene State Universitylocation not on record | 2 |
| J. Rusek Collectionlocation not on record | 2 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 2 |
| UoB-IBlocation not on record | 1 |
| Plocation not on record | 1 |
| Fayetteville, US | 1 |
| FLADlocation not on record | 1 |
| Ischia Marine Centrelocation not on record | 1 |
| KNFSClocation not on record | 1 |
| The University of Arizonalocation not on record | 1 |
| Arizona State University Biocollectionslocation not on record | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| Shanxi Universitylocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| GB | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| AZE006location not on record | 1 |
| Alicante, ES | 1 |
| Millersville, US | 1 |
| H-Meierottlocation not on record | 1 |
| Orem, US | 1 |
| Kingston, US | 1 |
| NMBU:MINAlocation not on record | 1 |
| CZE082location not on record | 1 |
| San Jose, US | 1 |
| KIWElocation not on record | 1 |
| Fukushima Universitylocation not on record | 1 |
| Trois-Rivières, CA | 1 |
| Henderson, US | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Montréal, CA | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| Sion, CH | 1 |
| Fribourg, CH | 1 |
| SIHUlocation not on record | 1 |
| Columbia, US | 1 |
| Santa Barbara, US | 1 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 1 |
| Austin, US | 1 |
| Wuhan, CN | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Grand Junction, US | 1 |
| Eastern Nevada Landscape Coalitionlocation not on record | 1 |
| Badajoz, ES | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Davis, US | 1 |
| Long Beach, US | 1 |
| DASSHlocation not on record | 1 |
| Honolulu, US | 1 |
| Loja, EC | 1 |
| Emporia, US | 1 |
| CASlocation not on record | 1 |
| New Brunswick, US | 1 |
| Rocky Mountain Biological Laboratorylocation not on record | 1 |
| US | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Namur, BE | 1 |
| Monastir, TN | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| BG-NMNHSlocation not on record | 1 |
| HJAEFlocation not on record | 1 |
| Durham, US | 1 |
| Toronto, CA | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| San Isidro, AR | 1 |
309 institutions · 27 877 of 28 930 vouchered records shown · 812 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA31 detections
Where the DNA of Festuca ovina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found31
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 31 detections have coordinates
Open the map7 countries0
cultivated in Botanic Garden; ORIGINAL_HABIT…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median11.4 °C 8.90–14.9
Seasonal swing summer↔winter13.9 °C
Max temp (day)13.2 °C 11.0–18.6
Min temp (night)8.50 °C 5.90–12.2
Precipitation70.6 mm/mo 51.5–123
Air humidity61.7 % 58.4–65.3
Moisture balance-26.2 mm/mo
Vapour deficit484 Pa 378–702
Wind speed4.60 m/s
Cloud cover46.2 % 41.8–64.3
CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.