Festuca longifolia

Thuill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Festuca

At a glance

Occurrence records4 174

Data sources10

Biological traits20

DNA specimens3

eDNA detections2

Sources10 archives

Databases and archives Festuca longifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 174 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources20 traits

Occurrence & distributionGBIF4 174 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT6.2 Gbp

01Narrative

Festuca longifolia est une plante herbacée de la famille des Poacées.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology7

Leaf size32 mm²

Plant height0.16 m

⚠ sources differ — GIFT: 0.16 m · LEDA: 0.16 m · TRY: 0.35 m

Plant height generative0.2 m

Seed length3 mm

Seed mass0.608 mg

⚠ sources differ — TRY: 0.608 mg · LEDA: 0.381 mg · GIFT: 0.464 mg

Seed mass max0.8 mg

Seed mass min0.38 mg

Life cycle & reproduction4

Deciduousnessaestival

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Stem erect

Woodinessnon-woody

Physiology & chemistry2

Leaf p2.5 mg/g

Photosynthetic pathwayC3

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Festuca longifolia has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF997420.1 ↗672 bp

ACGT

GCAAGTGTTGGATTTCAAGCTGGTGTTAAAGATTATAAATTGACTTACTACACCCCGGAGTATGAAACCAAGGATACTGATATCTTGGCA …

Festuca longifolia isolate BF301 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Festuca longifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size6 210 300 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Festuca longifolia6.21 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidy6× hexaploid · measured

Chromosome records14–422n range28median14mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 145×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · nw-europe-fl +1

GoaT · DTOL Flowering Plants Estimates Kew

CCDB · brit-fl — Wilkinson, M.J. (1986)

CCDB · brit-fl — Al-Bermani, A.-K.K.A. (1991)

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4448

CCDB · fl-europaea — Hubbard, 1954

2n 425×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · brit-fl +2

GoaT · DTOL Flowering Plants Estimates Kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · brit-fl — Maude, P.F. New Phytol. 39: 17-32 (1940)

CCDB · book-atlas-flowering-plants — Maude 1940

CCDB · kew — Arumuganathan K, Tallury SP, Fraser ML, Bruneau AH, Qu R. 1999. Nuclear DNA content of thirteen turfgrass species by flow cytometry. Crop Science 39: 1518-1521.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

hexaploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 174 records

Wild obs. + sensor4 099

Museum / vouchered74

Other1

Origin

Native173

Introduced3

Range

Area of Occupancy AOO4 036 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy26% within 1 km

≤100 m 519≤1 km 464≤10 km 2 815>10 km 4

3 802 georeferenced · 297 without coordinates

Open the mapobservation + sensor4 099

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 5≤1 km 22≤10 km 22>10 km 1

50 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence74

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BClocation not on record	16
BDBClocation not on record	13
South Kensington, GB	10
Barcelona, ES	6
BSBIlocation not on record	5
Paris, FR	4
MeiseBGlocation not on record	4
BMlocation not on record	1
Royal Botanic Gardens, Kewlocation not on record	1
WTUlocation not on record	1
Dresden, DE	1
Museo Entomologico de Leonlocation not on record	1
University of Stellenboschlocation not on record	1
OXF\|RAMM\|TORlocation not on record	1
Frankfurt am Main	1

15 institutions · 66 of 74 vouchered records shown · 8 without an institution code

09Environmental DNA2 detections

Where the DNA of Festuca longifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

garden

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.6 °C 17.6–17.6

Seasonal swing summer↔winter12.7 °C

Max temp (day)21.2 °C

Min temp (night)13.2 °C

Precipitation47.2 mm/mo

Air humidity59.9 %

Moisture balance-67.1 mm/mo

Vapour deficit804 Pa

Wind speed2.50 m/s

Cloud cover41.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Festuca longifolia

At a glance

Sources10 archives

Size & morphology7

Life cycle & reproduction4

Diet & foraging1

Habitat & environment6

Physiology & chemistry2

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type4 174 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 174 records