Festuca livida

(Kunth) Willd. ex Spreng. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Festuca

At a glance

Occurrence records92

Data sources6

Biological traits9

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Festuca livida's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility92 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF92 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 28

01Narrative

Festuca livida là một loài thực vật có hoa trong họ Hòa thảo. Loài này được (Kunth) Willd. ex Spreng. mô tả khoa học đầu tiên năm 1824.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Festuca livida has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR784970.1 ↗6 527 bpMexico

ACGT

TGTTGCCTTTGAGATAATGTTGCCCCTGTAACGTTATCGTTACTGGTGCGACACCCGCGCGCTGTGGACACTCAGGACGCCTACATCAAG …

Festuca livida isolate Flivi1 small subunit ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and large subunit ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Festuca livida carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 141×CCDB · Cave1962

CCDB · Cave1962 — Beaman et al. 1962

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type92 records

Museum / vouchered92

Range

Area of Occupancy AOO140 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 29≤1 km 5≤10 km 20>10 km 3

57 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence92

10Collections & institutions

Holding institutions10 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	36
East Lansing, US	13
PRClocation not on record	6
Kew, GB	4
Ann Arbor, US	4
Saint Louis, US	3
Montecillo, Texcoco, MX	2
Mexico City, MX	2
Wlocation not on record	2
Adam Mickiewicz University in Poznańlocation not on record	2
Chapingo, MX	1
Texas A&M Universitylocation not on record	1
International Salmonella Centre (W.H.O.)location not on record	1
University of Stellenboschlocation not on record	1
Chicago, US	1
TLAXlocation not on record	1
California Academy of Scienceslocation not on record	1
ASUlocation not on record	1
NO DISPONIBLElocation not on record	1
Austin, US	1

20 institutions · 84 of 92 vouchered records shown · 8 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)