Festuca lemanii

T.Bastard · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Festuca

At a glance

Occurrence records27 277

Data sources10

Biological traits16

DNA specimens13

eDNA detections8

Sources10 archives

Databases and archives Festuca lemanii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility27 277 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources16 traits

Occurrence & distributionGBIF27 277 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD · NCBI13 specimens

Genome at a glanceCCDB · GoaT6.8 Gbp

01Narrative

Festuca lemanii, la Fétuque de Léman, est une espèce du genre Festuca et de la famille des Poaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesLEDAGIFTWCVPTRY

Size & morphology1

Plant height0.707 m

Life cycle & reproduction4

Dispersal typeanimal

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Mycorrhiza type0.00000000471

Woodinessnon-woody

Physiology & chemistry2

Photosynthetic pathwayC3

Seed longevity index0

Other traits1

Plant support typefree-standing

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Festuca lemanii has left across the world's sequence archives.

At a glance

DNA specimens13

Marker genes4

GenBank sequences10

eDNA detections8

Countries5

The DNA barcodea real sequence read deposited for this species

ITSKX166434.1 ↗444 bpUnited Kingdom · 1989

ACGT

TGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCTGGCCGAGGGCACGCCTGCCTGGGCGTCACGCCAA …

Festuca lemanii voucher NMW3321 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Festuca lemanii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size6 826 440 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Festuca lemanii6.83 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidy6× hexaploid · measured

Chromosome records42–422n range42median42mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 428×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · brit-fl +5

GoaT · DTOL Flowering Plants Estimates Kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · brit-fl — Wilkinson, M.J., Stace, C.A. Bot. J. Linn. Soc. 106: 347-397 (1991)

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4447

CCDB · fl-europaea — Auquier &

CCDB · ipcn-api-dl — Smarda. 2005. Ploidy level variability of some central European fescues (Festuca subg.) (Festuca, Poaceae). Biologia (Bratislava) 60(1): 25–36.

CCDB · book-ipcn73-74 — AUQUIER, P., & J. RAMMELOO. 1973. Nombres chromosomiques dans le genre Festuca en Belgique et dans les regions limitrophes. Bull. Soc. Roy. Bot. Belgique 106: 317-328.

CCDB · kew — Smarda P, Bures P, Horova L, Foggi B, Rossi G. 2008. Genome size and GC content evolution of Festuca: Ancestral expansion and subsequent reduction. Annals of Botany 101: 421-433.

n 211×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — AUQUIER, P., & J. RAMMELOO. 1973. Nombres chromosomiques dans le genre Festuca en Belgique et dans les regions limitrophes. Bull. Soc. Roy. Bot. Belgique 106: 317-328.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

hexaploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type27 277 records

Wild obs. + sensor26 917

Museum / vouchered313

Other47

Origin

Native32

Introduced917

Range

Area of Occupancy AOO28 720 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy8% within 1 km

≤100 m 970≤1 km 777≤10 km 20 357>10 km 352

22 456 georeferenced · 4 461 without coordinates

Open the mapobservation + sensor26 917

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 16≤1 km 96≤10 km 52

164 georeferenced · 149 without coordinates

Open the institutions mapphysical evidence313

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BDBClocation not on record	79
MeiseBGlocation not on record	42
BClocation not on record	32
Entomological Society of Latvialocation not on record	28
Barcelona, ES	16
Corvallis, US	14
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	7
Lausanne, CH	7
Nijmegen, NL	6
Paris, FR	5
Namur, BE	3
WTUlocation not on record	3
Frankfurt am Main	3
Vitoria, ES	3
National Museum Waleslocation not on record	2
CJBGlocation not on record	2
Saint Louis, US	2
CJBNlocation not on record	1
GBR016location not on record	1
Berlin, DE	1
Pullman, US	1
Zürich, CH	1
València, ES	1
Banyoles, ES	1
Madrid, ES	1
Naturalis Biodiversity Centerlocation not on record	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1

27 institutions · 264 of 313 vouchered records shown · 49 without an institution code

09Environmental DNA8 detections

Where the DNA of Festuca lemanii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.5 °C 10.5–11.7

Seasonal swing summer↔winter11.0 °C

Max temp (day)14.0 °C 14.0–14.3

Min temp (night)6.20 °C 6.20–8.90

Precipitation111 mm/mo 69.9–111

Air humidity63.1 % 62.1–63.1

Moisture balance1.30 mm/mo -41.6–1.30

Vapour deficit468 Pa 468–525

Wind speed5.50 m/s 4.70–5.50

Cloud cover44.2 % 36.5–44.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Festuca lemanii

At a glance

Sources10 archives

Size & morphology1

Life cycle & reproduction4

Diet & foraging1

Habitat & environment7

Physiology & chemistry2

Other traits1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type27 277 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type27 277 records