Festuca laxa

Host · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Festuca

At a glance

Occurrence records19

Data sources10

Biological traits16

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Festuca laxa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility19 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources16 traits

Occurrence & distributionGBIF19 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GoaT6.3 Gbp

01Narrative

Festuca laxa là một loài thực vật có hoa trong họ Hòa thảo. Loài này được Host mô tả khoa học đầu tiên năm 1802.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYLEDAGIFTWCVP

Size & morphology3

Plant height0.425 m

Plant height max0.6 m

Plant height min0.3 m

Life cycle & reproduction5

Flowering endAug

Flowering startJun

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Festuca laxa has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKY368816.1 ↗596 bpSlovakia

ACGT

TCGTGACCCTGACCAAAATAGACCGCGCACGCGTCATCCAGCCCGCCGGGCGGCGGCACCGTTCGTCGCCCGGCCAAGGTCCTCGAAAAC …

Festuca laxa voucher Gutermann et al. 38483 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Festuca laxa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size6 322 770 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Festuca laxa6.32 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidy4× tetraploid · measured

Chromosome records28–422n range28median28mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 283×GoaT · Kew Plant DNA C-values Database · CCDB · book-ipcn65 · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-ipcn65 — Gervais 1965

CCDB · kew — Smarda P, Bures P, Horova L, Foggi B, Rossi G. 2008. Genome size and GC content evolution of Festuca: Ancestral expansion and subsequent reduction. Annals of Botany 101: 421-433.

2n 421×CCDB · book-ipcn72

CCDB · book-ipcn72 — LOVKA, M., F. SUSNIK, A. LOEVE, & D. LOEVE. 1972. In IOPB chromosome number reports XXXVI. Taxon 21: 333-346.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

tetraploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type19 records

Museum / vouchered17

Other2

Range

Area of Occupancy AOO56 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 7≤1 km 4≤10 km 2

13 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence17

10Collections & institutions

Holding institutions3 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
GJOlocation not on record	4
Salzburg, AT	3
Wlocation not on record	2
Provincia di Livornolocation not on record	1
BRNUlocation not on record	1
Dresden, DE	1
Zürich, CH	1
Dipartimento di Scienze della Vita dell'Università degli Studi di Trieste \| Department of Life Sciences of the University of Triestelocation not on record	1
Universität Göttingenlocation not on record	1
GZUlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

11 institutions · 17 of 17 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Festuca laxa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)