Festuca kurtziana

St.-Yves · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Festuca

At a glance

Occurrence records62

Data sources7

Biological traits12

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Festuca kurtziana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility62 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF62 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 42

01Narrative

Festuca kurtziana là một loài thực vật có hoa trong họ Hòa thảo. Loài này được St.-Yves mô tả khoa học đầu tiên năm 1927.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubalpine or subarctic

Climberself-supporting

Elevation max3 000 m

Elevation min600 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Festuca kurtziana has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR784966.1 ↗6 529 bpArgentina

ACGT

TGTTGCCTTTGAGATAAAGTTGCCCCTGTAACGTTATCGTTGCCGGTGCGACACCCGCGCGCTGTGGACACTCAGGACGCCTACATCAAG …

Festuca kurtziana isolate Fkurt2 small subunit ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and large subunit ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Festuca kurtziana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 421×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Dubcovsky, J. & A. J. Martínez. 1991. Chromosome complement and nucleoli in the Festuca pallescens alliance from South America. Canad. J. Bot. 69: 2756–2761.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type62 records

Wild obs. + sensor1

Museum / vouchered55

Cultivated / captive4

Other2

Origin

Native7

Range

Area of Occupancy AOO132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence55

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ciudad Autónoma de Buenos Aires, AR	17
Córdoba, AR	14
San Isidro, AR	8
Kew, GB	2
Herbario Universidad de Concepciónlocation not on record	2
Universidad Nacional de La Pampalocation not on record	2
Laboratory of Palaeontologylocation not on record	2
University of Stellenboschlocation not on record	2
Saint Louis, US	2
Berlin, DE	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Castelar, AR	1

12 institutions · 54 of 55 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)