Festuca hallii

(Vasey) Piper · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Festuca

At a glance

Occurrence records253

Data sources10

Biological traits12

DNA specimens9

eDNA detections5

Sources10 archives

Databases and archives Festuca hallii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility253 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF253 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Festuca hallii (also known as Piper plains rough fescue) which can be found in Central Canada and in such US states as New Mexico, North Dakota, Montana, Washington, and Wyoming.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Mycorrhiza typenon-mycorrhizal

Woodinessnon-woody

Physiology & chemistry1

Specific leaf area (SLA)8.96 mm²/mg

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Festuca hallii has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes5

GenBank sequences9

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG216783.1 ↗296 bpCanada · 1951

ACGT

TGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTTTTGGCCGAGGGCACGCCTGCCTGGGCGTCACGCAAA …

Festuca hallii voucher CCDB-23967-B08 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4★rbcLa★trnL-F★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Festuca hallii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 281×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Pavlick, L. E. & J. Looman. 1984. Taxonomy and nomenclature of rough fescues, Festuca altaica, F. campestris (F. scabrella var. major), and F. hallii, in Canada and the adjacent part of United States. Canad. J. Bot. 62: 1759–1749.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type253 records

Wild obs. + sensor138

Museum / vouchered115

Range

Area of Occupancy AOO708 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 91≤1 km 14≤10 km 3>10 km 15

123 georeferenced · 15 without coordinates

Open the mapobservation + sensor138

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 20≤1 km 11≤10 km 15>10 km 1

47 georeferenced · 68 without coordinates

Open the institutions mapphysical evidence115

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	43
WINlocation not on record	18
University of Alberta Museumslocation not on record	18
University of Stellenboschlocation not on record	5
Bronx, US	4
Wuzhou, CN	3
Agriculture and Agri-Food Canadalocation not on record	3
Denver, US	2
Missoula, US	2
University of Lethbridgelocation not on record	1
Albuquerque, US	1
Vancouver, CA	1
Victoria, CA	1
Flagstaff, US	1
Logan, US	1
Pullman, US	1
Moscow, US	1
Montréal, CA	1
Wlocation not on record	1
Bozeman, US	1
Research Collection of Jonathan Farrlocation not on record	1

21 institutions · 110 of 115 vouchered records shown · 4 without an institution code

09Environmental DNA5 detections

Where the DNA of Festuca hallii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

fush on bank of Arm River vally (otherwise t…scattered plants on sheltered slope of Souri…rather abudnant in the grassland bordering t…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 1.00–19.6

Seasonal swing summer↔winter32.7 °C

Max temp (day)22.5 °C 5.40–26.2

Min temp (night)11.1 °C -2.60–14.6

Precipitation71.2 mm/mo 60.8–99.0

Air humidity56.7 % 55.7–62.1

Moisture balance-71.5 mm/mo -93.3–-2.00

Vapour deficit822 Pa 357–1,012

Wind speed4.10 m/s 2.50–5.10

Cloud cover40.8 % 36.7–51.2

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)