Festuca elmeri

Scribn. & Merr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Festuca

At a glance

Occurrence records166

Data sources9

Biological traits10

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Festuca elmeri's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility166 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF166 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 28

01Narrative

Festuca elmeri is a species of grass known by the common names coast fescue and Elmer's fescue. It is a bunchgrass native to the US states of California and Oregon, where it often grows in wet, shady areas in coastal counties.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoid

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Festuca elmeri has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV126348.1 ↗706 bpUSA · 1948

ACGT

TAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTGACCCTGACCAAAACAGACCGCGCACGC …

Festuca elmeri voucher Howell 1534/24310 (US) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Festuca elmeri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 281×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Stebbins & L. 1941

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type166 records

Wild obs. + sensor7

Museum / vouchered159

Range

Area of Occupancy AOO528 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 5>10 km 1

6 georeferenced · 1 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 2≤1 km 38≤10 km 45

85 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence159

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Davis, US	43
San Luis Obispo, US	21
Santa Cruz, US	9
Corvallis, US	8
Angwin, US	8
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	7
Canadian Department of Agriculturelocation not on record	6
CASlocation not on record	6
Kew, GB	6
Arcata, US	5
Claremont, US	4
Santa Barbara, US	3
Saint Louis, US	2
Istituto Agrario Castelnuovolocation not on record	2
Los Angeles, US	2
San Diego, US	2
Logan, US	2
Riverside, US	2
Ashland, US	2
Moscow, US	1
KNFHClocation not on record	1
Severin-McDaniel Insect Collectionlocation not on record	1
GB	1
Bureau of Land Management, Medford District Officelocation not on record	1
Fredericton Stock Culture Collectionlocation not on record	1

25 institutions · 146 of 159 vouchered records shown · 13 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)