Festuca dasyclada

Beal · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Festuca

At a glance

Occurrence records99

Data sources7

Biological traits13

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Festuca dasyclada's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility99 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF99 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 28

01Narrative

Festuca dasyclada là một loài thực vật có hoa trong họ Hòa thảo. Loài này được Beal mô tả khoa học đầu tiên năm 1887.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.961 mg

Seed mass max0.96 mg

Seed mass min0.96 mg

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubalpine or subarctic

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoid

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Festuca dasyclada has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV126344.1 ↗706 bpUSA · 1976

ACGT

TAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTGACCCTGACCAAAACAGACCGCGCACGC …

Festuca dasyclada voucher Irvine 193 & Chichester (US) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Festuca dasyclada carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 281×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Aiken, S. & G. Fedak. 1992. Cytotaxonomic observations on North American Festuca (Poaceae). Canad. J. Bot. 70: 1940–1944.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type99 records

Museum / vouchered99

Range

Area of Occupancy AOO208 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 6≤10 km 6

12 georeferenced · 87 without coordinates

Open the institutions mapphysical evidence99

10Collections & institutions

Holding institutions12 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provo, US	25
Bronx, US	19
Musee des Dinosaures d'Esperaza (Aude)location not on record	19
Logan, US	13
Riverside, US	4
Moscow, US	4
Denver, US	2
Chongqing Museumlocation not on record	2
ASUlocation not on record	2
Pocatello, US	1
Wuzhou, CN	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Phoenix, US	1
Jena Microbial Resource Collectionlocation not on record	1
US	1
San Luis Obispo, US	1
Grand Junction, US	1
University of Alberta Museumslocation not on record	1

18 institutions · 99 of 99 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)