Festuca campestris

Rydb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Festuca

At a glance

Occurrence records588

Data sources10

Biological traits90

DNA specimens19

eDNA detections4

Sources10 archives

Databases and archives Festuca campestris's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility588 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources90 traits

Occurrence & distributionGBIF588 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI19 specimens

Genome at a glanceCCDB2n = 56

01Narrative

Festuca campestris là một loài thực vật có hoa trong họ Hòa thảo. Loài này được Rydb. mô tả khoa học đầu tiên năm 1900.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology2

Plant height0.46 m

Seed mass2.21 mg

Life cycle & reproduction25

After harvest regrowth rateModerate

Bloom periodMid Summer

Coppice potentialNo

Flower colouryellow

Flower conspicuousNo

Fruit seed period beginSummer

Fruit seed period endFall

Growth rate USDASlow

Life formperennial

Life spanperennial

Lifespan categoryModerate

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Raunkiær life formhemicryptophyte

Resprout abilityNo

Seed spread rateSlow

Seedling vigorMedium

Vegetative spread rateNone

Diet & foraging1

Parasiteindependent

Habitat & environment24

Active growth periodSpring and Summer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerModerate

Foliage porosity winterPorous

Foliage textureCoarse

Fruit colourbrown

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoid

Growth form USDABunch

Hedge toleranceNone

Known allelopathYes

Leaf retentionNo

Low growing grassNo

Root depth min14 in

Shape and orientationErect

Small grainNo

Woodinessnon-woody

Physiology & chemistry19

Anaerobic toleranceNone

C:N ratioMedium

Caco3 toleranceLow

Cold stratification requiredNo

Drought toleranceLow

Fertility requirementMedium

Fire resistantNo

Fire toleranceMedium

Frost free days min90 days

Moisture useLow

Nitrogen fixation levelNone

Precipitation max24 in

Precipitation min16 in

Protein potentialMedium

Salinity toleranceNone

Shade toleranceMedium

Soil pH max8 pH

Soil pH min6 pH

Temperature min-38 °F

Uses & economy15

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityField Collections Only

Fodder productYes

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable browse animalLow

Palatable graze animalMedium

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound205 388 per lb

ToxicityNone

Veneer productNo

Other traits4

Fall conspicuousNo

Fruit seed abundanceMedium

Fruit seed conspicuousNo

Fruit seed persistenceNo

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Festuca campestris has left across the world's sequence archives.

At a glance

DNA specimens19

Marker genes10

GenBank sequences8

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV126341.1 ↗706 bpUSA · 1977

ACGT

TAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTGACCCTGACCAAAACAGACCGCGCACGC …

Festuca campestris voucher Lackschewitz 7288 (US) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL5★rbcLa★trnL-F★ITS1atpF-atpHpsbK-psbIrpoBrpoC1trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Festuca campestris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 56 n = 28

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 561×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Pavlick, L. E. & J. Looman. 1984. Taxonomy and nomenclature of rough fescues, Festuca altaica, F. campestris (F. scabrella var. major), and F. hallii, in Canada and the adjacent part of United States. Canad. J. Bot. 62: 1759–1749.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type588 records

Wild obs. + sensor272

Museum / vouchered316

Origin

Native2

Range

Area of Occupancy AOO1 780 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 163≤1 km 25≤10 km 7>10 km 24

219 georeferenced · 53 without coordinates

Open the mapobservation + sensor272

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 13≤1 km 48≤10 km 28>10 km 3

92 georeferenced · 224 without coordinates

Open the institutions mapphysical evidence316

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Victoria, CA	63
Missoula, US	50
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	45
Bozeman, US	34
University of Stellenboschlocation not on record	22
University of Alberta Museumslocation not on record	21
WTUlocation not on record	17
Corvallis, US	12
Vancouver, CA	8
Logan, US	5
University of Lethbridgelocation not on record	4
Bronx, US	3
Pittsburg, US	3
Caldwell, US	2
Tacoma, US	2
Canadian Museum of Nature, National Herbarium of Canadalocation not on record	2
Bend, US	2
DOI/NPS, Greenbelt Parklocation not on record	2
Pullman, US	2
Research Collection of B. A. Bennettlocation not on record	1
Columbia, US	1
Ashland, US	1
Cheney, US	1
Kew, GB	1
Provo, US	1
Moscow, US	1
Wuzhou, CN	1
Grand Junction, US	1
Bureau of Land Management, Medford District Officelocation not on record	1
DOI/NPS, Colonial National Historical Parklocation not on record	1
Chongqing Museumlocation not on record	1
Research Collection of Jonathan Farrlocation not on record	1
Boise, US	1

33 institutions · 313 of 316 vouchered records shown · 3 without an institution code

09Environmental DNA4 detections

Where the DNA of Festuca campestris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C -0.4–14.8

Seasonal swing summer↔winter25.4 °C

Max temp (day)18.5 °C 5.00–21.4

Min temp (night)5.30 °C -6.30–9.10

Precipitation67.6 mm/mo 61.1–85.1

Air humidity54.7 % 53.5–56.5

Moisture balance-50.5 mm/mo -64.6–-13.4

Vapour deficit642 Pa 304–767

Wind speed3.10 m/s 2.40–5.20

Cloud cover39.7 % 36.1–41.9

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)