Festuca caerulescens

Desf. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Festuca

At a glance

Occurrence records13

Data sources6

Biological traits7

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Festuca caerulescens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Occurrence & distributionGBIF13 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 14

01Narrative

Festuca caerulescens là một loài thực vật có hoa trong họ Hòa thảo. Loài này được Desf. mô tả khoa học đầu tiên năm 1798.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Life cycle & reproduction1

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment4

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding7 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Festuca caerulescens has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences7

Countries3

The DNA barcodea real sequence read deposited for this species

ITSJQ972941.1 ↗592 bpSpain

ACGT

ATCCTGACCAAAACAGACCGCGCACGAGTCATCTAGCCCGCCGGGCGGCGGCACCGTTCGTCGCTCGGCCAAAGTCCTCGACAACCTCCT …

Festuca coerulescens voucher UZ 19.08 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS6

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Festuca caerulescens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 141×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — GOULD, F.W. 1970. In IOPB chromosome number reports XXV. Taxon 19: 102-113.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type13 records

Museum / vouchered13

Range

Area of Occupancy AOO36 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 6

6 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence13

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Barcelona, ES	5
Entomological Society of Latvialocation not on record	1
València, ES	1
Sevilla, ES	1

4 institutions · 8 of 13 vouchered records shown · 5 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)