Festuca amethystina

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Festuca

At a glance

Occurrence records5 193

Data sources10

Biological traits26

DNA specimens1

eDNA detections7

Sources10 archives

Databases and archives Festuca amethystina's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 193 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources26 traits

Occurrence & distributionGBIF5 193 records

Environmental DNA2 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Festuca amethystina, également connue sous le nom de fétuque touffue, est une espèce d'herbe de la famille des Poacées. Elle est originaire d'Europe, y compris la Turquie. Elle a pour synonymes : - Festuca capillata Lam. in Fl. Franç. 3: 597 (1779), nom. superfl. - Festuca ovina var. amethystina (L.) Asch. & Graebn. in Syn. Mitteleur. Fl. 2(1): 488 (1900), nom. illeg. - Festuca ovina var. capillata Heynh. in Nom. Bot. Hort.: 331 (1840) - Festuca ovina subsp. capillata (Heynh.) Arcang. in Comp. Fl. Ital. (1882) - Poa capillata Mérat in Nouv. Fl. Env. Paris, ed. 2: 27 (1821), nom. superfl.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology7

Plant height0.425 m

⚠ sources differ — GIFT: 0.425 m · LEDA: 0.425 m · TRY: 0.683 m

Plant height generative0.85 m

Plant height max0.8 m

Plant height min0.3 m

Seed mass0.31 mg

Seed mass max0.31 mg

Seed mass min0.31 mg

Life cycle & reproduction7

Deciduousnessevergreen

Dispersal typewind

Flowering endJun

Flowering startJun

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry3

Leaf dry-matter content (LDMC)716 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)9.93 mm²/mg

Other traits2

Diaspore typefruit with appendage

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Festuca amethystina has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences9

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPP334924.1 ↗598 bpCroatia · 2019

ACGT

TCGTGACCCTGACCAAAACAGACCGCGCACACGTCATCCTGCCTGCCGGGCGGCGGCACCGTTTGTCGCCCGGCCAAAGTCCTCGAAAAC …

Festuca amethystina isolate Fb611 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Festuca amethystina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidypolyploid inferred

Chromosome records14–282n range28median28mode12records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 287×CCDB · slov-fl · CCDB · ipcn-api-dl · CCDB · kew +1

CCDB · slov-fl — Uhríková A. & Bernátová D., 2000: Karyologické štúdium slovenskej flóry XXXII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 40: 31-36.

CCDB · slov-fl — Šmarda P. & Kočí K., 2003: Chromosome number variability in central european members of the Festuca ovina and F. pallens groups (sect. Festuca). - Folia Geobotanica 38/1: 65-95.

CCDB · ipcn-api-dl — Smarda. 2005. Ploidy level variability of some central European fescues (Festuca subg.) (Festuca, Poaceae). Biologia (Bratislava) 60(1): 25–36.

CCDB · ipcn-api-dl — Hand, R. & T. Gregor. 2011. Chromosomenzahlen von Farn- und Samenpflanzen aus Deutschland 5. Kochia 5: 33–38.

CCDB · ipcn-api-dl — `marda, P. & K. Kočí. 2003. Chromosome number variability in Central European members of the Festuca ovina and F. pallens groups (sect. Festuca). Folia Geobot. 38(1): 65–95.

CCDB · kew — Smarda P, Bures P, Horova L, Foggi B, Rossi G. 2008. Genome size and GC content evolution of Festuca: Ancestral expansion and subsequent reduction. Annals of Botany 101: 421-433.

CCDB · Cave1962 — Baksay 1956

2n 145×CCDB · brit-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2

CCDB · brit-fl — Maude, P.F. New Phytol. 38: 1-31 (1939)

CCDB · ipcn-api-dl — Engelskjon, T. 1979. Chromosome numbers in vascular plants from Norway, including Svalbard. Opera Bot. 52: 1–38.

CCDB · book-ipcn67-71 — PARREAUX, M.-J. 1971. Etude du nombre chromosomique de quelques espece xerophile du Jera. Actes du Colloque sur la flore et la vegetation des Chaines Alpine et Jurassienne. Paris. pp. 113-126.

CCDB · book-northern-plants — Church 1936.

CCDB · book-atlas-flowering-plants — Litardiere 1950

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type5 193 records

Wild obs. + sensor4 643

Museum / vouchered460

Other90

Range

Area of Occupancy AOO3 304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 156≤1 km 2 728≤10 km 1 026>10 km 4

3 914 georeferenced · 729 without coordinates

Open the mapobservation + sensor4 643

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 15≤1 km 54≤10 km 143>10 km 7

219 georeferenced · 241 without coordinates

Open the institutions mapphysical evidence460

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Wrocławskilocation not on record	56
Frankfurt am Main	52
Salzburg, AT	32
Zürich, CH	29
BFLlocation not on record	28
Zürich, CH	28
Bern, CH	27
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	25
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	23
SZUlocation not on record	19
Mlocation not on record	15
BRNUlocation not on record	15
LDlocation not on record	14
ER-Gaucklocation not on record	13
GJOlocation not on record	11
Adam Mickiewicz University in Poznańlocation not on record	9
Provincia di Livornolocation not on record	9
KFGBlocation not on record	7
Wlocation not on record	5
GZUlocation not on record	5
PRClocation not on record	3
CJBGlocation not on record	3
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	2
Oskarshamn, SE	2
Auckland, NZ	2
MAlocation not on record	2
Porrentruy, CH	2
Moscow State Universitylocation not on record	2
Bourges, FR	2
Frauenfeld, CH	2
NoColllocation not on record	2
Denver, US	1
Beijing, CN	1
Fribourg, CH	1
ER Hellerlocation not on record	1
Paris, FR	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Royal Botanical Gardenslocation not on record	1
Uppsala, SE	1
Dresden, DE	1

40 institutions · 455 of 460 vouchered records shown · 5 without an institution code

09Environmental DNA7 detections

Where the DNA of Festuca amethystina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 12.8–16.8

Seasonal swing summer↔winter20.8 °C

Max temp (day)21.2 °C 16.9–21.2

Min temp (night)11.8 °C 7.50–11.8

Precipitation79.2 mm/mo 79.2–157

Air humidity59.0 % 59.0–60.8

Moisture balance-35.6 mm/mo -35.6–44.2

Vapour deficit787 Pa 618–787

Wind speed2.60 m/s 2.60–3.20

Cloud cover30.6 % 30.6–34.3

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Festuca amethystina

At a glance

Sources10 archives

Size & morphology7

Life cycle & reproduction7

Diet & foraging1

Habitat & environment6

Physiology & chemistry3

Other traits2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type5 193 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 40 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 193 records