Festuca alpina

Suter · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Festuca

At a glance

Occurrence records3 138

Data sources9

Biological traits24

DNA specimens5

eDNA detections3

Sources9 archives

Databases and archives Festuca alpina's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 138 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources24 traits

Occurrence & distributionGBIF3 138 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 14

01Narrative

الفستوكة الألبية نوع نباتي يتبع جنس الفستوكة من الفصيلة النجيلية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology7

Leaf size10.22 mm²

Plant height0.05 m

⚠ sources differ — GIFT: 0.05 m · LEDA: 0.05 m · TRY: 0.044 m

Plant height generative0.075 m

Plant height max0.2 m

Plant height min0.05 m

Seed length5.24 mm

Seed mass0.156 mg

Life cycle & reproduction6

Deciduousnessaestival

⚠ sources differ — TRY: aestival · GIFT: deciduous

Flowering endJul

Flowering startJun

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry3

Leaf dry-matter content (LDMC)370 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)5.83 mm²/mg

Other traits2

Diaspore typefruit with appendage

Plant support typefree-standing

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Festuca alpina has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes2

GenBank sequences8

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKF917224.1 ↗598 bp

ACGT

TCGTGACCCTGACCAAAACAGACCGCGCACGCGTCATCCTGCCTGCCGGGCGGCGGCACCGTCTGTCGCCCAGCCAAAGTCCTCGAAAAC …

Festuca alpina isolate Valpi1_3 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★trnL★ITS8

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Festuca alpina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 147×CCDB · fl-europaea · CCDB · ipcn-api-dl · CCDB · kew +1

CCDB · fl-europaea — Parreaux, 1972

CCDB · ipcn-api-dl — Seal, A. G. 1983. DNA variation in Festuca. Heredity 50: 225–236.

CCDB · ipcn-api-dl — de la Fuente, V., L. M. Ferrero & E. Ortúñez. 2001. Chromosome counts in the genus Festuca L. section Festuca (Poaceae) in the Iberian Peninsula. Bot. J. Linn. Soc. 137(4): 385–398.

CCDB · kew — Smarda P, Bures P, Horova L, Foggi B, Rossi G. 2008. Genome size and GC content evolution of Festuca: Ancestral expansion and subsequent reduction. Annals of Botany 101: 421-433.

CCDB · CromoCat 2015 — Kozuharov, S. & Petrova, A. (1976). Chromosome studies of the higher plants with euroasiatic distribution in Bulgaria. Fragm. Florist. Geobot. 22(3): 301-322.

CCDB · CromoCat 2015 — Seal, A. G. (1983). DNA variation in Festuca. Heredity; an international journal of genetics 50: 225-236

CCDB · CromoCat 2015 — Kozuharov, S. J. & Petrova, A. V. (1973). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XL]. Taxon 22(2/3): 286-287.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 138 records

Wild obs. + sensor2 701

Museum / vouchered374

Other63

Range

Area of Occupancy AOO3 852 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy22% within 1 km

≤100 m 263≤1 km 154≤10 km 1 426>10 km 25

1 868 georeferenced · 833 without coordinates

Open the mapobservation + sensor2 701

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 29≤1 km 21≤10 km 179

229 georeferenced · 145 without coordinates

Open the institutions mapphysical evidence374

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Salzburg, AT	101
BFLlocation not on record	55
Frankfurt am Main	25
Glarus, CH	25
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	21
BDBClocation not on record	14
Bern, CH	11
SZUlocation not on record	10
Zürich, CH	9
Barcelona, ES	8
Dhaka, BD	8
Lausanne, CH	7
BClocation not on record	7
Provincia di Livornolocation not on record	7
LfUlocation not on record	6
BRNUlocation not on record	6
Mlocation not on record	5
GJOlocation not on record	5
Adam Mickiewicz University in Poznańlocation not on record	3
CJBGlocation not on record	3
Wlocation not on record	3
Dresden, DE	3
Zürich, CH	3
MAlocation not on record	3
Sion, CH	2
University of Salzburglocation not on record	2
Bourges, FR	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
GZUlocation not on record	2
Bronx, US	2
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	1
València, ES	1
CICYTEXlocation not on record	1
Universität Göttingenlocation not on record	1

34 institutions · 364 of 374 vouchered records shown · 10 without an institution code

09Environmental DNA3 detections

Where the DNA of Festuca alpina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

calcareous rocks, sunny sitesalpine mainly calcareous thermophilous open …

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.30 °C 7.70–10.8

Seasonal swing summer↔winter19.4 °C

Max temp (day)13.6 °C 12.0–15.2

Min temp (night)4.00 °C 2.30–5.60

Precipitation229 mm/mo 194–264

Air humidity64.4 % 63.9–64.8

Moisture balance117 mm/mo 81.6–152

Vapour deficit423 Pa 376–471

Wind speed5.10 m/s 4.80–5.40

Cloud cover36.0 % 35.7–36.4

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Festuca alpina

At a glance

Sources9 archives

Size & morphology7

Life cycle & reproduction6

Diet & foraging1

Habitat & environment5

Physiology & chemistry3

Other traits2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 138 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 138 records