Ferula persica

Willd. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Apiaceae/Ferula

At a glance

Occurrence records11

Data sources9

Biological traits8

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Ferula persica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility11 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Chemical compositionLOTUS · NPASS42 compounds

Occurrence & distributionGBIF11 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Ferula persica, la Férule persique, Férule de Perse ou Férule à sagapénum, est une espèce de plantes à fleurs de la famille des Apiaceae et du genre Ferula. Elle est originaire du Caucase et d'Iran, où on en extrait une gomme-résine appelée sagapénum ou gomme séraphique.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology1

Plant height min1 m

Life cycle & reproduction2

Life formperennial

Life spanperennial

Habitat & environment5

Climatetemperate

Elevation max2 000 m

Growth formherb

Habitat GIFTmountains

Woodinessnon-woody

03Chemical composition42 compounds

Compounds documented for Ferula persica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Simple coumarins16

Amarylidaceae alkaloids10

Stigmastane steroids5

Wax monoesters4

Amarylidaceae alkaloids $ Isoquinoline alkaloids3

Documented compounds42 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-8-Demethylmaritidine	present	NPASS
(-)-Galantamine	present	NPASS
(1R,12S,14S)-9-methoxy-11-oxa-4-azatetracyclo[8.6.1.01,12.06,17]heptadeca-6(17),7,9-trien-14-ol	present	NPASS
(1R,13R,15S)-5,7-dioxa-12-azapentacyclo[10.5.2.01,13.02,10.04,8]nonadeca-2,4(8),9,16-tetraen-15-ol	present	NPASS
(1S,11S,13R,16S,18S)-18-methoxy-15-methyl-5,7,12-trioxa-15-azapentacyclo[11.7.0.01,16.02,10.04,8]icosa-2,4(8),9,19-tetraen-11-ol	present	NPASS
(1S,13R,15S,18S)-5,7-dioxa-12-azapentacyclo[10.5.2.01,13.02,10.04,8]nonadeca-2,4(8),9,16-tetraene-15,18-diol	present	NPASS
(1S,2R,4S)-1,7,7-trimethylbicyclo[2.2.1]heptan-2-yl 4-hydroxy-3-methoxybenzoate	present	LOTUS
(2R,3R,4S,5S,6R)-2-[[(2S,4aR,4bS,6aR,7R,10aS,10bS)-7-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-4a,6a-dimethyl-1,2,3,4,4b,5,6,7,8,9,10,10a,10b,11-tetradecahydrochrysen-2-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2R,3R,4S,5S,6S)-2-[[(3S,8S,9S,10R,13R,14S,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(5alpha,11S,13beta,19alpha)-1,2-Didehydro-3beta-methoxycrinan-11-ol	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ferula persica has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR773128.1 ↗603 bpIran · 1984

ACGT

TCGAATCCTGCAATAGCAGAATGACCCGTTAACACGTAAAAACATCGGGAAGCTTCGGGGGGCCTATGGTCCCCTATTTGCGAACCCAAG …

Ferula persica var. persica voucher TARI 51639 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

08Occurrence & distribution

Record type11 records

Wild obs. + sensor2

Museum / vouchered8

Cultivated / captive1

Range

Area of Occupancy AOO20 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Moscow State Universitylocation not on record	8

1 institutions · 8 of 8 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Ferula persica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)