Ferula jaeschkeana

Vatke · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Apiaceae/Ferula

At a glance

Occurrence records40

Data sources9

Biological traits24

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Ferula jaeschkeana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility40 records↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources24 traits

Chemical compositionDukesPhytochem · LOTUS47 compounds

Occurrence & distributionGBIF40 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

Ferula jaeschkeana est une espèce de plantes à fleurs de la famille des Apiaceae et du genre Ferula. Elle est parfois citée parmi les plantes productrices d'ase fétide, même si sa gomme-résine a une composition phytochimique très différente. Celle-ci possède néanmoins plusieurs composés actifs dotés de propriétés pharmacologiques potentielles.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology10

Fruit length17 mm

Fruit length max20 mm

Fruit length min14 mm

Fruit width10 mm

Fruit width max12 mm

Fruit width min8 mm

Inflorescence length max10 cm

Inflorescence length min3 cm

Plant height2 m

Plant height min1 m

Life cycle & reproduction4

Flowering endJun

Flowering startMay

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatetemperate

Climberself-supporting

Elevation max3 600 m

Elevation mean3 600 m

Elevation min3 600 m

Growth formherb

Habitat GIFTmountains, shrubberies

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition47 compounds

Compounds documented for Ferula jaeschkeana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

💊 Medicinal use documented

Compound class profile5 classes

Daucane sesquiterpenoids16

Menthane monoterpenoids $ Monocyclic monoterpenoids6

Simple coumarins3

Menthane monoterpenoids2

Cadinane sesquiterpenoids $ Zizaane sesquiterpenoids2

Documented compounds47 total

Tissue Source Quantified only

Compound	Amount	Source
EO	38,000 ppm	DukesPhytochem
D-A-PINENE	34,200 ppm	DukesPhytochem
CAMPHENE	9,500 ppm	DukesPhytochem
AZULENE	1,900 ppm	DukesPhytochem
CUMINALDEHYDE	494 ppm	DukesPhytochem

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ferula jaeschkeana has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

rbcLKX527155.1 ↗1 282 bp

ACGT

TTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGC …

Ferula jaeschkeana voucher CPG12690 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Ferula jaeschkeana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Ahmad, I. & A. K. Koul. 1980. In Chromosome number reports LXVIII. Taxon 29: 543.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type40 records

Museum / vouchered23

Other17

Range

Area of Occupancy AOO148 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 18

18 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence23

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
GMBAlocation not on record	16
BRNUlocation not on record	2
Kunming, CN	2
Saint Louis, US	1
Uniwersytet Opolskilocation not on record	1
Dehra Dun, IN	1

6 institutions · 23 of 23 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)