Ferocactus wislizeni

(Engelm.) Britton & Rose · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Ferocactus

At a glance

Occurrence records19 772

Data sources11

Biological traits89

DNA specimens3

eDNA detections4

Sources11 archives

Databases and archives Ferocactus wislizeni's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility19 772 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources89 traits

Occurrence & distributionGBIF19 772 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB1.4 Gbp

01Narrative

Large fishhook barrel cactus near Sahuarita, Arizona Ferocactus wislizeni, the fishhook barrel cactus, also called Arizona barrel cactus, candy barrel cactus, and Southwestern barrel cactus, is a species of flowering plant in the cactus family Cactaceae, native to northern Mexico and the southern United States. It is a ball-shaped cactus eventually growing to a cylindrical shape, with spiny ribs and red or yellow flowers in summer. Some sources mistakenly spell the epithet "wislizenii." The correct spelling is with one "i," per ICN article 60C.2.J. McMeill et al. (eds). 2012. International Code of Nomenclature for algae, fungi, and plants. Regnum Vegetabile 154. Koeltz Scientific Books.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology4

Plant height3.4 m

⚠ sources differ — GIFT: 3.4 m · USDA: 3.35 m · TRY: 1.35 m

Seed mass3 mg

⚠ sources differ — TRY: 3 mg · GIFT: 1.55 mg

Seed mass max3 mg

Seed mass min2.47 mg

Life cycle & reproduction22

Bloom periodLate Spring

Coppice potentialNo

Flower colourorange

Flower conspicuousYes

Fruit seed period beginSummer

Fruit seed period endSummer

Growth rate USDASlow

Life formsucculent subshrub or shrub

Life spanperennial

Lifespan categoryLong

Propagated by bare rootYes

Propagated by bulbNo

Propagated by containerYes

Propagated by cormNo

Propagated by cuttingsYes

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityNo

Seed spread rateSlow

Seedling vigorMedium

Habitat & environment22

Active growth periodSummer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsYes

BloatNone

Climatedesert or dry shrubland

Climberself-supporting

Foliage colorGreen

Foliage porosity summerPorous

Foliage porosity winterPorous

Foliage textureCoarse

Fruit colourblack

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Tree, Shrub

Growth form USDASingle Stem

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min6 in

Shape and orientationClimbing

Small grainNo

Woodinessvariable

⚠ sources differ — TRY: non-woody/woody · GIFT: woody

Physiology & chemistry19

Anaerobic toleranceNone

C:N ratioHigh

Caco3 toleranceHigh

Cold stratification requiredNo

Drought toleranceHigh

Fertility requirementLow

Fire resistantNo

Fire toleranceNone

Frost free days min160 days

Moisture useLow

Nitrogen fixation levelNone

Precipitation max24 in

Precipitation min9 in

Protein potentialLow

Salinity toleranceLow

Shade toleranceHigh

Soil pH max8.5 pH

Soil pH min7 pH

Temperature min-23 °F

Uses & economy15

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityContracting Only

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productYes

Palatable browse animalLow

Palatable graze animalLow

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound1 000 000 per lb

ToxicityNone

Veneer productNo

Other traits7

Fall conspicuousNo

Fruit seed abundanceHigh

Fruit seed conspicuousYes

Fruit seed persistenceYes

Height at 20yr1.22 m

Planting density max300 per acre

Planting density min170 per acre

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ferocactus wislizeni has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences3

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLJN796938.1 ↗666 bp

ACGT

TACAAATTGACTTATTATACTCCTGAATATCAACCCCAGGATACCGATATCTTGGCAGCATTCCGAGTAAGTCCTCAACCTGGAGTTCCG …

Ferocactus wislizeni ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Ferocactus wislizeni carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 369 200 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Ferocactus wislizeni1.37 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 223×CCDB · ipcn-api-dl · CCDB · eflora · CCDB · book-fedorov

CCDB · ipcn-api-dl — Das, A. B., S. Mohanty, R. H. Marrs & P. Das. 2000. Interspecific variations of nuclear DNA content and karyotype diversity in Ferocactus. Cytologia 65: 49–56.

CCDB · eflora

CCDB · book-fedorov — Katagiri 1953 aljibe

n 112×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74

CCDB · ipcn-api-dl — Das, P., S. Mohanty & A. B. Das. 2000. Interspecific variations in the chiasma frequency and nuclear DNA content in some species of Ferocactus (Cactaceae). Caryologia 53: 159–162.

CCDB · book-ipcn73-74 — PINKAVA, D.J., M.G. MCLEOD, L.A. MCGILL, & R.C. BROWN. 1973. Chromosome numbers in some cacti of western North America-II. Brittonia 25: 2-9.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type19 772 records

Wild obs. + sensor19 502

Museum / vouchered269

Cultivated / captive1

Origin

Native16

Range

Area of Occupancy AOO22 488 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤100 m 8≤1 km 12≤10 km 3>10 km 19 464

19 487 georeferenced · 15 without coordinates

Open the mapobservation + sensor19 502

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 16≤1 km 16≤10 km 21>10 km 15

68 georeferenced · 201 without coordinates

Open the institutions mapphysical evidence269

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Phoenix, US	132
ASUlocation not on record	45
Bronx, US	17
Albuquerque, US	13
Flagstaff, US	12
Claremont, US	7
Philadelphia, US	7
Mexico City, MX	5
Austin, US	4
Chongqing Museumlocation not on record	4
St. Paul, US	4
Chicago, US	3
Riverside, US	3
Saint Louis, US	3
Austin, US	1
Ciudad Juárez, MX	1
San Angelo, US	1
USFSlocation not on record	1
San Luis Obispo, US	1
San Diego, US	1
Bloomington, US	1

21 institutions · 266 of 269 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Ferocactus wislizeni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.7–22.2

Seasonal swing summer↔winter9.60 °C

Max temp (day)22.0 °C 22.0–26.5

Min temp (night)9.00 °C 9.00–17.3

Precipitation34.7 mm/mo 34.7–127

Air humidity50.9 % 50.9–60.5

Moisture balance-93.3 mm/mo -93.3–-0.9

Vapour deficit884 Pa 884–1,050

Wind speed4.10 m/s 2.50–4.10

Cloud cover25.5 % 25.5–29.6

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ferocactus wislizeni

At a glance

Sources11 archives

Size & morphology4

Life cycle & reproduction22

Habitat & environment22

Physiology & chemistry19

Uses & economy15

Other traits7

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type19 772 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions18 of 21 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type19 772 records