Felipes leucopellaeus

(Ach.) Frisch & G.Thor · species

image placeholder — illustration coming later

Fungi/Ascomycota/Arthoniomycetes/Arthoniales/Arthoniaceae/Felipes

At a glance

Occurrence records15 806

Data sources7

Biological traits1

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Felipes leucopellaeus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility15 806 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF15 806 records

DNA & barcodingNCBIsequences

01Narrative

Arthonia leucopellaea is a species of lichen belonging to the family Arthoniaceae. It is native to Europe and Northern America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRY

Habitat & environment1

Growth formlichen

03Chemical composition1 compounds

Compounds documented for Felipes leucopellaeus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Depsides1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Atranorin		present	LOTUS

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Felipes leucopellaeus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

Countries3

The DNA barcodea real sequence read deposited for this species

ITSOQ717388.1 ↗573 bpAustria

ACGT

TAACGAGGCCAAGAGACTCCGCGCGAGCTCTCATCTCCTACCCGCGACGAACTTATCCGACCGGCGTTGCTTTGGTGGCGAGGCGCAACC …

Felipes leucopellaeus voucher PRA-Vondrak26693 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

08Occurrence & distribution

Record type15 806 records

Wild obs. + sensor15 162

Museum / vouchered642

Other2

Range

Area of Occupancy AOO25 832 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 10 932≤1 km 3 669≤10 km 245>10 km 1

14 847 georeferenced · 315 without coordinates

Open the mapobservation + sensor15 162

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 331≤1 km 86≤10 km 55>10 km 6

478 georeferenced · 164 without coordinates

Open the institutions mapphysical evidence642

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	169
Trondheim, NO	91
Bergen, NO	89
SLU Artdatabankenlocation not on record	54
University of Gdansklocation not on record	43
LDlocation not on record	42
Madison, US	26
Metsähallituslocation not on record	19
BioFokuslocation not on record	17
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	15
Helsinki, FI	13
MeiseBGlocation not on record	9
Stockholm, SE	8
CJBGlocation not on record	5
Uppsala, SE	5
nbflocation not on record	5
Kuopio, FI	4
Salzburg, AT	3
GZUlocation not on record	3
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	2
Staatsarchiv Urilocation not on record	2
San Sebastián, ES	1
Gijón, ES	1
Bronx, US	1
Santa Barbara, US	1
IB FRC Komi SC UB RASlocation not on record	1
Auckland, NZ	1
Turku, FI	1

28 institutions · 631 of 642 vouchered records shown · 11 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Felipes leucopellaeus

At a glance

Sources7 archives

Habitat & environment1

Compound class profile1 class

Documented compounds1 total

At a glance

Record type15 806 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 28 geolocated

Record type15 806 records