Fejervarya cancrivora

(Gravenhorst, 1829) · species

image placeholder — illustration coming later

Animalia/Chordata/Amphibia/Anura/Dicroglossidae/Fejervarya

At a glance

Occurrence records1 574

Data sources10

Biological traits14

DNA specimens101

eDNA detections120

Sources10 archives

Databases and archives Fejervarya cancrivora's data was compiled from.

WikipediaWikimedia Foundation13 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 571 records↗

OBISOcean Biodiversity Information System3 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI120 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics101 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Amphibian Species of the WorldAMNHamphibian catalog↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources14 traits

Occurrence & distributionGBIF · OBIS1 574 records

Environmental DNA1 datasets · 3 countries120 detections

DNA & barcodingBOLD101 specimens

Genome at a glanceGoaT2n = 26

01Narrative

The crab-eating frog (Fejervarya cancrivora) is a frog native to south-eastern Asia including Taiwan, China, the Philippines and more rarely as far west as Orissa in India.Rare species of frog, snake in Orissa It has also been introduced to Guam, and was most likely introduced from Taiwan.Wostl, Elijah, Eric N. Smith, and Robert N. Reed. 2016. Origin and Identity of Fejervarya (Anura: Dicroglossidae) on Guam. Pacific Science 70(2):233-241. https://doi.org/10.2984/70.2.9 It inhabits mangrove swamps and marshes and is one of only 144 known modern amphibians which can tolerate brief excursions into sea water. This frog can tolerate marine environments (immersion in sea water for brief periods or brackish water for extended periods) by increasing urea production and retention, and by remaining slightly hyperosmotic within urea and sodium flux. Adults can survive in salt water with salinity as high as 2.8%, and tadpoles can survive salinities as high as 3.9%.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBaseAmphiBIO

Size & morphology1

SVL11.3 cm

Life cycle & reproduction3

Litter size max1 187

Litter size min90

Reproductive output1 /year

Diet & foraging1

Arthropodsyes

Habitat & environment6

Habitat aquaticyes

Habitat arborealyes

Habitat brackishyes

Habitat freshwateryes

Habitat terrestrialyes

Habitat zoneothers

Other traits3

Offspring size max1.6 mm

Offspring size min1.6 mm

Repro larvalyes

05DNA & barcoding101 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Fejervarya cancrivora has left across the world's sequence archives.

At a glance

DNA specimens101

BINs4

Marker genes11

eDNA detections120

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus85 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 36 variable positions, in barcode order

1Avariable

58Gmostly conserved

61Tmostly conserved

64Cmostly conserved

70Tmostly conserved

88Gmostly conserved

94Gmostly conserved

103Tmostly conserved

121Gmostly conserved

127Cmostly conserved

172Tmostly conserved

190Gmostly conserved

193Cmostly conserved

196Amostly conserved

229Amostly conserved

232Tmostly conserved

235Cmostly conserved

253Gvariable

256Tmostly conserved

265Gmostly conserved

271Gmostly conserved

286Cmostly conserved

295Cmostly conserved

310Gmostly conserved

337Cmostly conserved

346Tmostly conserved

352Tmostly conserved

427Cmostly conserved

433Amostly conserved

454Cmostly conserved

490Tmostly conserved

538Tmostly conserved

544Cvariable

550Amostly conserved

595Cmostly conserved

619Amostly conserved

AACTATATACCTAATTTTTGGCGCCTGAGCCGGGATAATCGGAACTGCCCTCAGCCTGCTTATCCGAGCTGAACTTAGCCAGCCCGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes8

BINs3

Most divergent pair17.3%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Fejervarya limnocharissame genus17.8%Tetraodon miurussame order17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_012647 ↗ · 13 protein · 23 tRNA · 2 rRNA

ND5ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND6CYTBs-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT

The complete instruction manual Fejervarya cancrivora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Chromosome records26–262n range26median26mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 262×GoaT · Animal Chromosome Counts Database · GoaT · Amphibian Karyotype Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Amphibian Karyotype Database — ↗

07Deep time~18 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin18 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type1 574 records

Wild obs. + sensor897

Museum / vouchered676

Other1

Range

Area of Occupancy AOO2 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 248≤1 km 385≤10 km 76>10 km 64

773 georeferenced · 124 without coordinates

Open the mapobservation + sensor897

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 257≤1 km 28≤10 km 28

313 georeferenced · 363 without coordinates

Open the institutions mapphysical evidence676

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berkeley, US	300
Washington, US	286
Toronto, CA	32
Brussels, BE	7
RBINS-Scientific Heritagelocation not on record	6
University of Texas at Arlingtonlocation not on record	5
Sam Noble Oklahoma Museum of Natural Historylocation not on record	3
Zacatecas, MX	3
Western Australian Museumlocation not on record	1
Vietnam Academy of Science and Technology, Institute of Tropical Biologylocation not on record	1
Nong Lam Universitylocation not on record	1
Honolulu, US	1

12 institutions · 646 of 676 vouchered records shown · 29 without an institution code

09Environmental DNA120 detections

Where the DNA of Fejervarya cancrivora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found120

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 120 detections have coordinates

Open the map3 countries0

Rice FieldMangovepond

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 23.8–27.2

Seasonal swing summer↔winter1.90 °C

Max temp (day)27.8 °C 26.4–30.2

Min temp (night)24.0 °C 20.3–25.5

Precipitation128 mm/mo 38.0–413

Air humidity68.2 % 61.9–69.8

Moisture balance-50.8 mm/mo

Vapour deficit1,070 Pa 890–1,360

Wind speed1.90 m/s

Cloud cover58.0 % 51.5–64.8

CHELSA 1981–2010, ~9 km grid, at location & month of 116 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Fejervarya cancrivora

At a glance

Sources10 archives

Size & morphology1

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Other traits3

At a glance

Chromosomes & ploidyhow the DNA is packaged

At a glance

When this lineage existed

Record type1 574 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 574 records