Fedia graciliflora

Fisch. & C.A.Mey. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Dipsacales/Caprifoliaceae/Fedia

At a glance

Occurrence records562

Data sources10

Biological traits6

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Fedia graciliflora's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility562 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources6 traits

Occurrence & distributionGBIF562 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT748 Mbp

01Narrative

Fedia graciliflora is a species of plants in the family Caprifoliaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRY

Size & morphology2

Leaf length17.5 mm

Leaf width20 mm

Life cycle & reproduction1

Life spanannual

Habitat & environment3

Growth formherb

Leaf shapeelliptical oblanceolate ovate spathulate

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Fedia graciliflora has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSAY310449.1 ↗637 bp

ACGT

TCGATTCCTGCAAGGAACGACCCGCGAACACGTTTTAAACCCGCAAGACGGACGCGGGAGTTTATTAAACTCCCGCGGCCGCCTTTAACC …

Fedia graciliflora internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Fedia graciliflora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size748 170 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Fedia graciliflora0.75 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidy4× tetraploid · measured

Chromosome records32–482n range32median32mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 327×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · kew +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Xena de Enrech, N., A. Cardona & J. Mathez. 1991. Estudio citotaxonómico del género Fedia Gaertn. (Valerianaceae). Anales Jard. Bot. Madrid 48: 157–169.

CCDB · kew — Hidalgo O, Mathez J, Garcia S, Garnatje T, Pellicer J, Vallès J. 2010. Genome size study in the Valerianaceae: first results and new hypotheses. Journal of Botany 2010: Article ID 797246, 19 pages.

CCDB · CromoCat 2015 — Xena de Enrech, N., M. À. Cardona & J. Mathez. (1991). Estudio citotaxonómico del género Fedia Gaertn. (Valerianaceae). Anales Jard. Bot. Madrid 48(2): 157-169.

2n 481×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Xena de Enrech, N., M. À. Cardona & J. Mathez. (1991). Estudio citotaxonómico del género Fedia Gaertn. (Valerianaceae). Anales Jard. Bot. Madrid 48(2): 157-169.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

tetraploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type562 records

Wild obs. + sensor456

Museum / vouchered106

Origin

Introduced1

Range

Area of Occupancy AOO1 584 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 167≤1 km 68≤10 km 47>10 km 48

330 georeferenced · 126 without coordinates

Open the mapobservation + sensor456

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 2≤1 km 4≤10 km 10>10 km 1

17 georeferenced · 89 without coordinates

Open the institutions mapphysical evidence106

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BIO-UNIPIlocation not on record	72
MAlocation not on record	9
UIBlocation not on record	5
BClocation not on record	4
Paris, FR	4
Museo Entomologico de Leonlocation not on record	4
Adelaide, AU	3
Frankfurt am Main	1
Wlocation not on record	1
Sevilla, ES	1
GJOlocation not on record	1
Kew, GB	1

12 institutions · 106 of 106 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Fedia graciliflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)