Fayodia bisphaerigera

(J.E.Lange) Singer · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Tricholomataceae/Fayodia

At a glance

Occurrence records409

Data sources8

Biological traits0

DNA specimens8

eDNA detections78

Sources8 archives

Databases and archives Fayodia bisphaerigera's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility409 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI78 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF409 records

Environmental DNA6 datasets · 7 countries78 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Fayodia bisphaerigera is a species of fungi in the family Tricholomataceae, and the type species of the genus Fayodia. The species was originally named Omphalia bisphaerigera by Jakob Emanuel Lange, and later transferred to Fayodia in 1936 by Rolf Singer. It is found in Asia, Europe, and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Fayodia bisphaerigera has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes2

GenBank sequences10

eDNA detections78

Countries7

The DNA barcodea real sequence read deposited for this species

ITSPZ272396.1 ↗303 bpUSA · 1956

ACGT

GAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACGCCTGTTTGAGTGTCATTAAATTCTCAACCTTGCCAGCTTTCACGAGGTTGGT …

Fayodia bisphaerigera isolate MICH CIB A. H. Smith 56360 voucher MICH:179626 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type409 records

Wild obs. + sensor220

Museum / vouchered187

Other2

Range

Area of Occupancy AOO1 160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy52% within 1 km

≤100 m 59≤1 km 49≤10 km 93>10 km 6

207 georeferenced · 13 without coordinates

Open the mapobservation + sensor220

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 27≤1 km 40≤10 km 38>10 km 6

111 georeferenced · 76 without coordinates

Open the institutions mapphysical evidence187

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Trondheim, NO	20
Olocation not on record	17
Helsinki, FI	14
Göteborg, SE	10
Karlsruhe, DE	10
Universidade de Lisboa, Museu Bocagelocation not on record	9
Uppsala, SE	8
Copenhagen, DK	7
SLU Artdatabankenlocation not on record	6
WTUlocation not on record	6
Kew, GB	4
Oulu, FI	4
WU-MYClocation not on record	3
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	3
nsnflocation not on record	3
	3
Joensuu, FI	3
Trondheim, NO	2
Zürich, CH	2
Turku, FI	2
California State University, East Baylocation not on record	2
TROMlocation not on record	2
Toronto, CA	1
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	1
University of Oslo, Natural History Museumlocation not on record	1
Royal Botanic Gardens, Kewlocation not on record	1
LDlocation not on record	1
Mlocation not on record	1
Chicago, US	1
Tromso University Museumlocation not on record	1
BDBClocation not on record	1
Salzburg, AT	1
Bronx, US	1

33 institutions · 151 of 187 vouchered records shown · 35 without an institution code

09Environmental DNA78 detections

Where the DNA of Fayodia bisphaerigera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found78

Studies independent surveys6

Countries7

Verifiable raw sequence linked26

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 78 detections have coordinates

Open the map7 countries0

i olderskog pÃ¥ fuktig skogbunn mell. bregnerGrasslandi olderskogPalearcticMiddle boreal, old, mesotr. (small fern) spr…Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 9.90–17.5

Seasonal swing summer↔winter21.7 °C

Max temp (day)19.0 °C 11.7–24.7

Min temp (night)9.80 °C 5.80–14.2

Precipitation76.8 mm/mo 21.7–94.5

Air humidity60.3 % 46.7–64.2

Moisture balance-22.9 mm/mo -143–35.5

Vapour deficit723 Pa 427–1,073

Wind speed2.30 m/s 1.50–3.20

Cloud cover43.7 % 27.5–58.7

CHELSA 1981–2010, ~9 km grid, at location & month of 76 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)