Favorinus blianus

Lemche & T.E.Thompson, 1974 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Facelinidae/Favorinus

At a glance

Occurrence records619

Data sources9

Biological traits2

DNA specimens16

eDNA detections15

Sources9 archives

Databases and archives Favorinus blianus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility486 records↗

OBISOcean Biodiversity Information System133 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS619 records

Environmental DNA1 datasets · 3 countries15 detections

DNA & barcodingBOLD16 specimens

Genome at a glanceGoaT · NCBI≈840 Mbp

01Narrative

Favorinus blianus is a species of sea slug, an aeolid nudibranch in the family Facelinidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Favorinus blianus has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections15

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

95Cmostly conserved

106Cmostly conserved

145Gmostly conserved

226Tmostly conserved

235Tmostly conserved

302Tmostly conserved

313Amostly conserved

322Gmostly conserved

340Cmostly conserved

343Cmostly conserved

361Tmostly conserved

367Cmostly conserved

403Amostly conserved

550Gmostly conserved

556Cmostly conserved

577Amostly conserved

601Cmostly conserved

AACTTTATATGTTCTTCTTGGAATGTGATGCGGTCTAGCTGGTACCGGGTTAAGGCTATTAATTCGGTTTGAGTTGGGGACTGCAGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.49%

Haplotypes9

BIN1

Most divergent pair1.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Favorinus branchialissame genus14.8%Favorinus auritulussame genus15.3%Favorinus tsuruganussame genus16.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Favorinus blianus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈839 630 212 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Favorinus blianus0.84 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness92.9% BUSCO

08Occurrence & distribution

Record type619 records

Wild obs. + sensor442

Museum / vouchered164

Other13

Range

Area of Occupancy AOO748 km²

Depth

0–200 m sunlit91

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 19 m · max 49 m · 91 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 304≤1 km 32≤10 km 7>10 km 1

344 georeferenced · 98 without coordinates

Open the mapobservation + sensor442

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 18≤1 km 16

34 georeferenced · 130 without coordinates

Open the institutions mapphysical evidence164

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bergen, NO	17
NTNU-VMlocation not on record	13
Gothenburg, SE	13
Citadel Hill, GB	1
CASlocation not on record	1
DASSHlocation not on record	1
Goteborg Natural History Museumlocation not on record	1
South Kensington, GB	1
SLU Artdatabankenlocation not on record	1

9 institutions · 49 of 164 vouchered records shown

09Environmental DNA15 detections

Where the DNA of Favorinus blianus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map3 countries0

Mixed bottomOn rock in kelpforestFlat mudHard substrate

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.00 °C 3.10–12.9

Seasonal swing summer↔winter12.6 °C

Max temp (day)8.40 °C 4.10–14.4

Min temp (night)4.60 °C 1.60–10.1

Precipitation99.2 mm/mo 51.6–273

Air humidity62.8 % 60.4–65.1

Moisture balance235 mm/mo

Vapour deficit384 Pa 284–518

Wind speed4.80 m/s

Cloud cover50.6 % 47.3–53.7

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)