Favolaschia calocera

R.Heim · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Mycenaceae/Favolaschia

At a glance

Occurrence records634

Data sources10

Biological traits0

DNA specimens8

eDNA detections8

Sources10 archives

Databases and archives Favolaschia calocera's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility634 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS39 compounds

Occurrence & distributionGBIF634 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Favolaschia calocera, commonly known as the orange pore fungus, is a species of fungus in the family Mycenaceae.Singer R (1986) The Agaricales in modern taxonomy, 4th edn. Koeltz Scientific Books, Koenigstein Due to its form it is also known as orange pore conch or orange Ping-Pong bat.Ainsworth AM, Farley D, Gainey P, Penna P, Suz LM, (2015) Invasion of the Orange Ping-Pong Bats: the rapidly changing distribution of Favolaschia calocera. Field Mycology, 16(4): 113-120. Throughout much of its expanded range F. calocera is now considered an invasive species. It colonizes ruderal sites along transport routes and can become dominant in habitats disturbed by human activity. Mycologists fear that it may be displacing native fungi species as it spreads through the paleotropics.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition39 compounds

Compounds documented for Favolaschia calocera across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Strobilurins and derivatives12

Miscellaneous alkaloids7

Arteminisin1

Anthracyclines1

Chalcones1

Documented compounds39 total

Tissue Source Quantified only

Compound	Amount	Source
(2S)-7-chloro-2-[(2R)-2-methyl-5-oxooxolan-2-yl]-2,3-dihydro-1-benzouran-5-carboxamide	present	NPASS
(3R)-2,4-dimethyl-5-phenyl-4-pentene-2,3-diol	present	NPASS
(5S,6R,Z)-3-methyl-6-phenyl-3-hexene-1,5,6-triol	present	NPASS
2-(1-Chloroprop-1-en-2-yl)-1-benzofuran-5-carboxamide	present	LOTUS
2-(Chloromethylidene)-1,3-benzodioxepine-7-carboxamide	present	LOTUS
2-(Chloromethylidene)-1,3-benzodioxepine-7-carboxylic acid	present	LOTUS
3-Hydroxy-2,2,4-trimethyl-5-phenylpent-4-enoic acid	present	NPASS
9-oxostrobilurin E	present	LOTUS
9-oxostrobilurin G	present	LOTUS
9-oxostrobilurin I	present	LOTUS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Favolaschia calocera has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes2

GenBank sequences10

eDNA detections8

Countries7

The DNA barcodea real sequence read deposited for this species

ITSOQ023311.1 ↗569 bpViet Nam · 2014

ACGT

TTGGAGGCTGATTAAACCCTGCCTCTGTTCCTCTGCGCACTCTTTACTGAGTTGCGGTCTGGGAGTTGTTAACCCTTCTCCTGCTTCACT …

Favolaschia calocera internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type634 records

Wild obs. + sensor544

Museum / vouchered90

Origin

Introduced1

Range

Area of Occupancy AOO1 424 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 146≤1 km 161≤10 km 95>10 km 10

412 georeferenced · 132 without coordinates

Open the mapobservation + sensor544

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 22≤1 km 21≤10 km 4

47 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence90

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Sebastián, ES	14
TENN-Flocation not on record	12
Museo Entomologico de Leonlocation not on record	9
Brisbane, AU	7
Kensington, AU	7
Leicester, GB	6
Canberra, AU	3
Durham, US	3
Hobart, AU	3
MeiseBGlocation not on record	3
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	3
Philadelphia, US	2
Kew, GB	2
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	2
St. Paul, US	2
Royal Botanic Gardens, Kewlocation not on record	1
Gijón, ES	1
National Institute of Biological Resourceslocation not on record	1
Bronx, US	1
Uppsala, SE	1
University of the Basque Country (UPV/EHU)location not on record	1
Instituto Nacional de Biodiversidad del Ecuadorlocation not on record	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1
JA-CAGPDS-CAMlocation not on record	1
Auckland, NZ	1
Paris, FR	1

26 institutions · 89 of 90 vouchered records shown · 1 without an institution code

09Environmental DNA8 detections

Where the DNA of Favolaschia calocera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.50 °C 5.50–5.50

Seasonal swing summer↔winter10.7 °C

Max temp (day)6.80 °C

Min temp (night)3.50 °C

Precipitation104 mm/mo

Air humidity65.4 %

Moisture balance66.4 mm/mo

Vapour deficit312 Pa

Wind speed5.80 m/s

Cloud cover54.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)