Faurea rochetiana

(A.Rich.) Chiov. ex Pic.Serm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Proteales/Proteaceae/Faurea

At a glance

Occurrence records841

Data sources8

Biological traits23

DNA specimens10

eDNA detections8

Sources8 archives

Databases and archives Faurea rochetiana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility841 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF841 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD · NCBI10 specimens

01Narrative

Faurea rochetiana, also known as the broad-leaved beechwood, is a tree found in much of Africa from Sudan south to Limpopo, Mpumalanga and northern KwaZulu-Natal. The tree is small and leafy. It has wider leaves, larger flowers and flower veins and also denser hairy twigs than the bushveld beechwood. The tree's national number is 76.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height9 m

Plant height max10 m

Plant height min3.5 m

Seed mass27.58 mg

Life cycle & reproduction5

Deciduousnessdeciduous

Dispersal typewind

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 500 m

Elevation min600 m

Epiphyteterrestrial

Growth formtree

Habitat GIFTecotone

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density715 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Faurea rochetiana has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes3

GenBank sequences10

eDNA detections8

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJF265430.1 ↗552 bpSouth Africa · 2007

ACGT

AGTGTCGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGACACCAAAGATACTGATATCTTGGCAGCA …

Faurea rochetiana voucher OM1413 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL5★rbcLa

plant barcode

08Occurrence & distribution

Record type841 records

Wild obs. + sensor435

Museum / vouchered348

Cultivated / captive58

Range

Area of Occupancy AOO1 540 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 238≤1 km 35≤10 km 9>10 km 1

283 georeferenced · 152 without coordinates

Open the mapobservation + sensor435

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 1≤1 km 3>10 km 1

5 georeferenced · 343 without coordinates

Open the institutions mapphysical evidence348

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy3% within 1 km

≤1 km 2≤10 km 55>10 km 1

58 georeferenced

Open the mapnot free-living58

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	120
MeiseBGlocation not on record	31
Cape Town, ZA	29
Kew, GB	23
Saint Louis, US	22
TAFORI-LSRClocation not on record	17
Durban, ZA	13
Paris, FR	10
Instituto de Investigação Científica Tropicallocation not on record	9
LNBG$location not on record	7
National Museums of Kenyalocation not on record	4
Stockholm, SE	4
WAGlocation not on record	4
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	3
MAlocation not on record	3
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	2
Haramaya Universitylocation not on record	2
Clocation not on record	2
Uppsala, SE	2
Dekalb, US	1
MSB-3054location not on record	1
DSMlocation not on record	1
Cape Town, ZA	1
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1
Leiden University Medical Centerlocation not on record	1
Addis Ababa, ET	1
University of Stellenboschlocation not on record	1
EAlocation not on record	1
Arusha, TZ	1
National Range Agencylocation not on record	1
Glocation not on record	1
Elocation not on record	1

32 institutions · 320 of 348 vouchered records shown · 28 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA8 detections

Where the DNA of Faurea rochetiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 21.3–23.0

Seasonal swing summer↔winter8.90 °C

Max temp (day)27.0 °C 26.2–27.7

Min temp (night)17.1 °C 16.0–18.1

Precipitation78.1 mm/mo 60.5–95.6

Air humidity58.7 % 58.2–59.3

Moisture balance-49.0 mm/mo -53.0–-45.0

Vapour deficit1,102 Pa 1,058–1,146

Wind speed2.60 m/s 2.50–2.70

Cloud cover30.7 % 26.6–34.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)