Fatsia oligocarpella

Koidz. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Araliaceae/Fatsia

At a glance

Occurrence records47

Data sources9

Biological traits9

DNA specimens13

eDNA detections7

Sources9 archives

Databases and archives Fatsia oligocarpella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility47 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources9 traits

Occurrence & distributionGBIF47 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI13 specimens

Genome at a glanceCCDB2n = 48

01Narrative

Fatsia oligocarpella is a species of flowering plant in the family Araliaceae, native to the Bonin Islands and the Volcano Islands, both belonging to Japan.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction3

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Fatsia oligocarpella has left across the world's sequence archives.

At a glance

DNA specimens13

Marker genes5

GenBank sequences10

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHG317066.1 ↗618 bp

ACGT

CTGCACACCAGAACGACCCGCGAACACGTTACCACACCGGGTGAGGGACCGGGGGTTCGCAAGTTCCCCTAGTTGCGAACCCATGGTCGG …

Fatsia oligocarpella genomic DNA containing ITS1, 5.8S rRNA gene and ITS2, isolate S19

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS4★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Fatsia oligocarpella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidypolyploid inferred

Chromosome records48–482n range48median48mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 482×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Ono, M. 1975. Chromosome numbers of some endemic species of the Bonin Islands I. Bot. Mag. (Tokyo) 88: 323–328.

CCDB · ipcn-api-dl — Ono, M. 1977a. Cytotaxonomical studies on the flowering plants endemic to the Bonin Islands. Mem. Natl. Sci. Mus. (Tokyo) 10: 63–80.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type47 records

Wild obs. + sensor14

Museum / vouchered33

Range

Area of Occupancy AOO48 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy29% within 1 km

≤100 m 3≤1 km 1≤10 km 6>10 km 4

14 georeferenced

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 15

15 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tsukuba, JP	15
Nishihara, JP	7
Forestry and Forest Products Research Institutelocation not on record	3

3 institutions · 25 of 33 vouchered records shown · 8 without an institution code

09Environmental DNA7 detections

Where the DNA of Fatsia oligocarpella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 23.7–26.8

Seasonal swing summer↔winter9.00 °C

Max temp (day)26.7 °C 24.3–27.4

Min temp (night)25.4 °C 23.0–26.1

Precipitation139 mm/mo 95.4–152

Air humidity65.6 % 63.2–66.3

Moisture balance-22.0 mm/mo

Vapour deficit1,221 Pa 1,003–1,252

Wind speed5.20 m/s

Cloud cover48.1 % 42.1–53.7

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)