Fasciola jacksoni

Cobbold, 1869 · species

image placeholder — illustration coming later

Animalia/Platyhelminthes/Trematoda/Plagiorchiida/Fasciolidae/Fasciola

At a glance

Occurrence records8

Data sources4

Biological traits0

DNA specimens11

eDNA detections14

Sources4 archives

Databases and archives Fasciola jacksoni's data was compiled from.

GBIFGlobal Biodiversity Information Facility8 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF8 records

Environmental DNA2 datasets · 5 countries14 detections

DNA & barcodingBOLD11 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Fasciola jacksoni has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes3

eDNA detections14

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P1 551 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

GTGAAGTATGTTAGTTGGTTGTTTACGTTAGATCATAAGCGTGTGGGATTAATTTATATGGTAATTGGTTTGTGGGGGGGGTTCCTTGGG …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS118S-5P

animal barcodefungal barcoderibosomal

08Occurrence & distribution

Record type8 records

Museum / vouchered8

Range

Area of Occupancy AOO24 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ARMS-MBONlocation not on record	4
München, DE	3
University of Guelphlocation not on record	1

3 institutions · 8 of 8 vouchered records shown

09Environmental DNA14 detections

Where the DNA of Fasciola jacksoni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys2

Countries5

Verifiable raw sequence linked4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map5 countries0

Long-Term Ecological Research Site; LHI (Low…Research site; semi-industrial; 9.5 - Subtid…Marine Protected Area; protected; 9.2 - Subt…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.7 °C 11.5–27.1

Seasonal swing summer↔winter3.80 °C

Max temp (day)30.2 °C 13.3–31.9

Min temp (night)22.7 °C 8.30–23.7

Precipitation51.5 mm/mo 36.2–171

Air humidity61.2 % 55.7–62.6

Moisture balance-63.7 mm/mo -164–-11.0

Vapour deficit1,315 Pa 544–1,409

Wind speed5.10 m/s 3.00–9.10

Cloud cover41.3 % 16.2–66.7

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)