Fargesia rufa — The Life Data

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Fargesia

At a glance

Occurrence records10

Data sources6

Biological traits12

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Fargesia rufa's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF10 records

DNA & barcodingNCBIsequences

01Narrative

Fargesia rufa is a woody bamboo native to western China. It is known in Chinese as qingchuan jianzhu (), meaning "Qingchuan Fargesia", Qingchuan being a county within the prefecture-level city of Guangyuan in the north of Sichuan. It is found at high elevations in the north of this province as well is in the south of Gansu. The plant is a significant source of food for the giant panda.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formbamboo

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatetemperate

Climberself-supporting

Elevation max2 300 m

Elevation mean1 940 m

Elevation min1 580 m

Epiphyteterrestrial

Growth formherb

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Fargesia rufa has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKP725330.1 ↗619 bp

ACGT

GGAAGGATCATTGTCGTGACCCTAACCAAAACAGACCGCGCACGCGTCATCCATGCCGCCGGGCGGCAGCCGCCGCCCGGCCTAGGCCCG …

Fargesia rufa 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK3rbcL2ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type10 records

Wild obs. + sensor4

Museum / vouchered6

Range

Area of Occupancy AOO20 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 3

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
University of Stellenboschlocation not on record	5

1 institutions · 5 of 6 vouchered records shown · 1 without an institution code