Fargesia nitida

(Mitford) Keng f. ex T.P.Yi · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Fargesia

At a glance

Occurrence records157

Data sources9

Biological traits22

DNA specimens8

eDNA detections5

Sources9 archives

Databases and archives Fargesia nitida's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility157 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Occurrence & distributionGBIF157 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Fargesia nitida, commonly named blue fountain bamboo, is a clumping bamboo native to Szechwan, China. Medium to small and very cold hardy, but not tolerant of very high summer temperatures. This species bloomed in the years 2002–2005, so is not expected to bloom again for another 120 years. This bloom is causing problems for the endangered Giant Panda, which consumes bamboo exclusively.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Fruit length5 mm

Fruit length max6 mm

Fruit length min4 mm

Leaf size1 125 mm²

Plant height5 m

Life cycle & reproduction3

Deciduousnessdeciduous

Life formbamboo

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatetemperate

Climberself-supporting

Elevation max3 800 m

Elevation mean2 890 m

Elevation min2 450 m

Epiphyteterrestrial

Growth formherb

Woodinesswoody

Physiology & chemistry4

Leaf c420 mg/g

Leaf dry-matter content (LDMC)466 mg/g

Leaf n17.3 mg/g

Leaf p1.13 mg/g

Other traits1

Plant support typefree-standing

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Fargesia nitida has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes3

GenBank sequences10

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMN433538.1 ↗618 bpChina

ACGT

GGAAGGATCATTGTCGTGACCCTAACCAAAACAGACCGCGCACGCGTCATCCATGCCGCCGGGCGGCATCCGCCGCTCGGCCCAGGCCCG …

Fargesia nitida isolate F2802 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type157 records

Wild obs. + sensor1

Museum / vouchered155

Cultivated / captive1

Range

Area of Occupancy AOO192 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 2

4 georeferenced · 151 without coordinates

Open the institutions mapphysical evidence155

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	55
Lanzhou, CN	41
Xian, CN	13
Zhengzhou, CN	10
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	6
LDlocation not on record	6
Bronx, US	4
Guilin, CN	4
Vancouver, CA	2
Logan, US	2
Saint Louis, US	2
Auckland, NZ	2
Canadian Museum of Nature, National Herbarium of Canadalocation not on record	1
Chengdu, CN	1
Moscow State Universitylocation not on record	1
MeiseBGlocation not on record	1
Clemson, US	1
Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record	1
SLU Artdatabankenlocation not on record	1

19 institutions · 154 of 155 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Fargesia nitida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.20 °C 5.20–5.20

Seasonal swing summer↔winter13.0 °C

Max temp (day)6.20 °C

Min temp (night)3.90 °C

Precipitation268 mm/mo

Air humidity63.5 %

Vapour deficit322 Pa

Cloud cover54.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)