Faerberia carbonaria

(Alb. & Schwein.) Pouzar · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Polyporales/Polyporaceae/Faerberia

At a glance

Occurrence records611

Data sources8

Biological traits0

DNA specimens2

eDNA detections2

Sources8 archives

Databases and archives Faerberia carbonaria's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility611 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF611 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Faerberia carbonaria Pouzar, 1981, dont le nom vernaculaire en français est Chanterelle des charbonnières est une espèce de champignons basidiomycètes. Faerberia carbonaria est la seule espèce du genre Faerberia, appartenant à la famille des Polyporaceae, genre décrit en 1981 par le mycologue tchèque Zdenek Pouzar. Poussant sur la terre brûlée des charbonnières, ce champignon a une teinte analogue à celle de la Chanterelle cendrée mais présente un pied plein et à chair blanchâtre, contrairement au pied creux de cette dernière. L'hyménium de la chanterelle des charbonnières se présente sous forme de plis blancs et ramifiés sous le chapeau, d'apparence similaire à ceux de certaines chanterelles ou craterelles.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Faerberia carbonaria has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences5

eDNA detections2

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMH298916.1 ↗599 bpMexico · 2015

ACGT

GTAGCTGGTCTTAACGGACATGTGCACGCCCCGACTCATCCAACTTTCTTACACCCTTGTGCACCTGTGTAGGTTGGTTGAAGGCCTGCC …

Faerberia carbonaria voucher MushroomObserver.org/210641 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5

fungal barcode

08Occurrence & distribution

Record type611 records

Wild obs. + sensor464

Museum / vouchered121

Other26

Range

Area of Occupancy AOO1 620 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy13% within 1 km

≤100 m 30≤1 km 28≤10 km 302>10 km 72

432 georeferenced · 32 without coordinates

Open the mapobservation + sensor464

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 7≤1 km 20≤10 km 37

64 georeferenced · 57 without coordinates

Open the institutions mapphysical evidence121

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	13
BDBClocation not on record	8
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	8
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	7
WU-MYClocation not on record	7
Copenhagen, DK	5
SLU Artdatabankenlocation not on record	5
Olocation not on record	4
MeiseBGlocation not on record	4
Karlsruhe, DE	4
JA-CAGPDS-CAMlocation not on record	4
Göteborg, SE	4
Salzburg, AT	3
MAlocation not on record	2
San Sebastián, ES	2
Royal Botanic Gardens, Kewlocation not on record	1
Mlocation not on record	1
Gijón, ES	1
Tartu, EE	1
Görlitz, DE	1
PRClocation not on record	1
Universidade de Lisboa, Museu Bocagelocation not on record	1
Ciudad de México, MX	1

23 institutions · 88 of 121 vouchered records shown · 33 without an institution code

09Environmental DNA2 detections

Where the DNA of Faerberia carbonaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 6.40–13.6

Seasonal swing summer↔winter16.3 °C

Max temp (day)12.8 °C 8.60–17.0

Min temp (night)6.10 °C 3.20–8.90

Precipitation96.4 mm/mo 88.6–104

Air humidity62.9 % 59.5–66.3

Moisture balance22.5 mm/mo -1.80–46.9

Vapour deficit491 Pa 336–645

Wind speed4.20 m/s 3.10–5.30

Cloud cover48.7 % 47.3–50.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)