Exserohilum turcicum

(Pass.) K.J.Leonard & Suggs · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Pleosporales/Pleosporaceae/Exserohilum

At a glance

Occurrence records265

Data sources11

Biological traits0

DNA specimens73

eDNA detections107

Sources11 archives

Databases and archives Exserohilum turcicum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility265 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI107 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics73 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS106 compounds

Occurrence & distributionGBIF265 records

Environmental DNA3 datasets · 10 countries107 detections

DNA & barcodingBOLD · NCBI73 specimens

Genome at a glanceGoaT · NCBI43 Mbp

01Narrative

Setosphaeria turcica (anamorph Exserohilum turcicum; formerly known as Helminthosporium turcicum) is the causal agent of northern corn leaf blight in maize. It is a serious fungal disease prevalent in cooler climates and tropical highlands wherever corn is grown. It is characterized by large cigar shaped necrotic lesions that develop on the leaves due to the polyketide metabolite monocerin.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition106 compounds

Compounds documented for Exserohilum turcicum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Stemona alkaloids32

Iridoids monoterpenoids10

Eudesmane sesquiterpenoids10

Germacrane sesquiterpenoids9

Oleanane triterpenoids3

Documented compounds106 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-alpha-Thujone	present	NPASS
(1R)-2,2,4-trimethyl-5-oxocyclohex-3-ene-1-carboxylic acid	present	NPASS
(1R,2R,3R,6R,7R,8R,14R,19R)-7-ethyl-8-hydroxy-3-methyl-19-[(2R,4R)-4-methyl-5-oxooxolan-2-yl]-5,17-dioxa-13,15-diazapentacyclo[11.4.2.01,14.02,6.08,14]nonadecane-4,16-dione	present	NPASS
(1R,2S,3S,6R,7S,14S)-7-ethyl-1-hydroxy-3-methyl-14-[(2S,4S)-4-methyl-5-oxooxolan-2-yl]-5-oxa-13-azatricyclo[11.2.1.02,6]hexadecane-4,8,16-trione	present	NPASS
(1R,2S,3S,6S,7R,10S)-2-ethyl-1-hydroxy-6-methyl-10-[(2S,4S)-4-methyl-5-oxooxolan-2-yl]-4-oxa-11-azatricyclo[9.4.1.03,7]hexadecane-5,8,16-trione	present	NPASS
(1R,3R,9R,10R,11S,14S,15S,16R)-10-ethyl-14-methyl-3-[(2S,4S)-4-methyl-5-oxooxolan-2-yl]-12-oxa-4-azatetracyclo[7.6.1.04,16.011,15]hexadecan-13-one	present	NPASS
(1R,3S,4S,7S,11S)-3-[(1R)-1-carboxypropyl]-4-hydroxy-2,10-dioxatricyclo[5.3.1.04,11]undeca-5,8-diene-8-carboxylic acid	present	NPASS
(1R,3S,9R,10R,11R,14S,15S,16R)-10-ethyl-14-methyl-3-[(2R,4S)-4-methyl-5-oxooxolan-2-yl]-12-oxa-4-azatetracyclo[7.6.1.04,16.011,15]hexadecan-13-one	present	NPASS
(1R,9R,10R,11S,14R,15S,16R)-10-ethyl-14-methyl-12-oxa-4-azatetracyclo[7.6.1.04,16.011,15]hexadecan-13-one	present	NPASS
(1S,2R,3S,3'S,4S,6R)-3-ethyl-3'-methylspiro[5-oxa-10-azatricyclo[8.3.0.02,6]tridecane-4,5'-oxolane]-2',11-dione	present	NPASS

05DNA & barcoding73 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Exserohilum turcicum has left across the world's sequence archives.

At a glance

DNA specimens73

Marker genes2

GenBank sequences10

eDNA detections107

Countries10

The DNA barcodea real sequence read deposited for this species

ITSPZ017518.1 ↗544 bpIndia · 2025

ACGT

TTTATCACCCTTGTCTTTTGCGCACTTGTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCACACCATAAACCTTTTTTATGCAGTTG …

Exserohilum turcicum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Exserohilum turcicum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size43 010 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Exserohilum turcicum0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

08Occurrence & distribution

Record type265 records

Wild obs. + sensor3

Museum / vouchered262

Range

Area of Occupancy AOO588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 2 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤100 m 2≤1 km 7≤10 km 152>10 km 9

170 georeferenced · 92 without coordinates

Open the institutions mapphysical evidence262

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ILLSlocation not on record	128
Catholic University of Pekinglocation not on record	40
Bronx, US	6
WU-MYClocation not on record	4
UAclocation not on record	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1

6 institutions · 180 of 262 vouchered records shown · 70 without an institution code

09Environmental DNA107 detections

Where the DNA of Exserohilum turcicum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found107

Studies independent surveys3

Countries10

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 107 detections have coordinates

Open the map10 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.1 °C 10.5–25.5

Seasonal swing summer↔winter13.1 °C

Max temp (day)23.9 °C 15.2–31.6

Min temp (night)14.3 °C 5.90–19.6

Precipitation72.0 mm/mo 10.2–198

Air humidity59.6 % 50.9–63.3

Moisture balance-12.3 mm/mo -127–56.0

Vapour deficit834 Pa 469–1,605

Wind speed2.30 m/s 2.00–2.80

Cloud cover37.0 % 17.2–43.4

CHELSA 1981–2010, ~9 km grid, at location & month of 44 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)