Exophiala phaeomuriformis

(Tad.Matsumoto, A.A.Padhye, Ajello & McGinnis) Matos, Haase & De Hoog · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Chaetothyriales/Herpotrichiellaceae/Exophiala

At a glance

Occurrence records14

Data sources9

Biological traits0

DNA specimens26

eDNA detections29

Sources9 archives

Databases and archives Exophiala phaeomuriformis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility14 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF14 records

Environmental DNA5 datasets · 5 countries29 detections

DNA & barcodingBOLD · NCBI26 specimens

Genome at a glanceGoaT · NCBI≈26 Mbp

01Narrative

Exophiala phaeomuriformis is thermophilic fungus belonging to the genus Exophiala and the family Herpotrichiellaceae. it is a member of the group of fungi known as black yeasts, and is typically found in hot and humid locations, such as saunas, bathrooms, and dishwashers. This species can cause skin infections and is typically classified as a Biosafety Risk Group 2 agent.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Exophiala phaeomuriformis has left across the world's sequence archives.

At a glance

DNA specimens26

Marker genes4

GenBank sequences10

eDNA detections29

Countries5

The DNA barcodea real sequence read deposited for this species

ITSON543765.1 ↗218 bpChina · 2018

ACGT

AAGGATCATTAAAGAGTTAGGGTCTCCTCAGGCCCGACCTCCCAACCCGTTGTTTACTGAACCACTTGTGTTGCTTCGGCGATGGCGCCC …

Exophiala phaeomuriformis isolate 285 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1★ITS25-8S

fungal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Exophiala phaeomuriformis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈25 868 297 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Exophiala phaeomuriformis0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

Completeness95.1% BUSCO

08Occurrence & distribution

Record type14 records

Museum / vouchered14

Range

Area of Occupancy AOO32 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 14 records without

Open the institutions mapphysical evidence14

10Collections & institutions

Institution	Specimens
University of Athens, Hellenic Collection of Pathogenic Fungilocation not on record	1

1 institutions · 1 of 14 vouchered records shown · 11 without an institution code

09Environmental DNA29 detections

Where the DNA of Exophiala phaeomuriformis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys5

Countries5

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map5 countries0

Indomalayan

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.7 °C 7.70–17.8

Seasonal swing summer↔winter16.2 °C

Max temp (day)15.6 °C 11.9–21.3

Min temp (night)7.60 °C 2.80–14.6

Precipitation58.1 mm/mo 32.8–78.6

Air humidity60.3 % 57.5–63.8

Moisture balance-40.8 mm/mo -89.4–-1.10

Vapour deficit565 Pa 434–844

Wind speed4.00 m/s 3.00–5.10

Cloud cover38.3 % 32.5–44.0

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)