Exophiala dermatitidis

(Kano) de Hoog · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Chaetothyriales/Herpotrichiellaceae/Exophiala

At a glance

Occurrence records47

Data sources12

Biological traits0

DNA specimens205

eDNA detections172

Sources12 archives

Databases and archives Exophiala dermatitidis's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility47 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI172 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics205 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS8 compounds

Occurrence & distributionGBIF47 records

Environmental DNA7 datasets · 7 countries172 detections

DNA & barcodingBOLD · NCBI205 specimens

Genome at a glanceGoaT · NCBI23 Mbp

01Narrative

Exophiala dermatitidis is a thermophilic black yeast, and a member of the Herpotrichiellaceae. While the species is only found at low abundance in nature, metabolically active strains are commonly isolated in saunas, steam baths, and dish washers. Exophiala dermatitidis only rarely causes infection in humans, however cases have been reported around the world. In East Asia, the species has caused lethal brain infections in young and otherwise healthy individuals. The fungus has been known to cause cutaneous and subcutaneous phaeohyphomycosis, and as a lung colonist in people with cystic fibrosis in Europe. In 2002, an outbreak of systemic E. dermatitidis infection occurred in women who had received contaminated steroid injections at North Carolina hospitals.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition8 compounds

Compounds documented for Exophiala dermatitidis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Farnesane sesquiterpenoids $ Hydrocarbons2

Unsaturated fatty acids1

Naphthoquinones1

Carboline alkaloids1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
(3aS)-6,8-dihydroxy-1-(1H-indol-3-yl)-3a,4-dihydrobenzo[e][1]benzofuran-2,5-dione	present	LOTUS
(3aS)-6-hydroxy-1-(1H-indol-3-yl)-3a,4-dihydrobenzo[e][1]benzofuran-2,5-dione	present	LOTUS
(6E,10E)-2,6,10-trimethyldodeca-2,6,10-triene	present	NPASS
(6E,10Z)-2,6,10-trimethyldodeca-2,6,10-triene	present	NPASS
Exophialin	present	LOTUS
Pityriacitrin	present	LOTUS
UZUXPANAZFDWJO-CABCVRRESA-N	present	NPASS
Ximenynic acid	present	NPASS

05DNA & barcoding205 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Exophiala dermatitidis has left across the world's sequence archives.

At a glance

DNA specimens205

Marker genes4

GenBank sequences10

eDNA detections172

Countries13

The DNA barcodea real sequence read deposited for this species

ITSPZ226303.1 ↗599 bpHungary · 2024

ACGT

AGGCCCGACCTCCCAACCCTTTGTTTACCCGACCCATGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGAGGACCGCCTATTCAG …

Exophiala dermatitidis isolate T838B internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1★ITS25-8S

fungal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Exophiala dermatitidis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size22 685 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Exophiala dermatitidis0.02 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type47 records

Museum / vouchered47

Range

Area of Occupancy AOO96 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 47 records without

Open the institutions mapphysical evidence47

10Collections & institutions

Institution	Specimens
Scientific Institute of Public Health, Brusselslocation not on record	7
University of Athens, Hellenic Collection of Pathogenic Fungilocation not on record	4
Institut Pasteur de Lillelocation not on record	3
Queen Elizabeth II Medical Centrelocation not on record	3
Sydney Medical Schoollocation not on record	2
Aix-Marseille Universitylocation not on record	1
Institut Pasteur, Parislocation not on record	1

7 institutions · 21 of 47 vouchered records shown · 25 without an institution code

09Environmental DNA172 detections

Where the DNA of Exophiala dermatitidis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found172

Studies independent surveys7

Countries7

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 172 detections have coordinates

Open the map7 countries0

Indomalayan

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH6.63 5.30–8.56

Conductivity3,200 µS/cm 16.0–111,000

Organic carbon0.67 % 0.15–2.83

Water content2.74 % 0.452–23.4

Nitrate-N3.00 mg/kg 1.00–7.00

Phosphorus15.0 mg/kg 2.00–116

Clay15.8 % 3.36–49.0

Sand77.2 % 40.0–95.5

Depth0 m 0–0.2

SoilLatLon out of rangeKandosolTenosolsRudosolTenosolVertosol

16 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.8 °C 10.4–26.6

Seasonal swing summer↔winter13.2 °C

Max temp (day)28.8 °C 13.8–33.0

Min temp (night)15.7 °C 6.70–21.2

Precipitation24.8 mm/mo 4.50–73.3

Air humidity46.9 % 42.8–63.7

Moisture balance-104 mm/mo -145–4.40

Vapour deficit1,354 Pa 495–2,023

Wind speed4.00 m/s 2.40–4.90

Cloud cover27.1 % 19.3–43.8

CHELSA 1981–2010, ~9 km grid, at location & month of 59 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)