Exocarpos sparteus

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Santalales/Santalaceae/Exocarpos

At a glance

Occurrence records3 535

Data sources8

Biological traits43

DNA specimens2

eDNA detections2

Sources8 archives

Databases and archives Exocarpos sparteus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 535 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources43 traits

Occurrence & distributionGBIF3 535 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Exocarpos sparteus is an Australian endemic plant species, commonly known as the broom ballart, slender cherry, or native cherry. The species is found in all states of mainland Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology18

Fruit length4.25 mm

Fruit width4.25 mm

Leaf length7 mm

Leaf length max10 mm

Leaf length min2 mm

Leaf mass68.2 mg

Leaf mass per area287 g/m2

Leaf size239 mm²

Leaf width1 mm

Plant height4 m

Plant height max6 m

Plant height min1 m

Seed mass51.54 mg

Seed mass max51.54 mg

Seed mass min51.54 mg

Seed volume54 mm³

Seed volume max54 mm³

Seed volume min54 mm³

Life cycle & reproduction10

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timeyyyyyyyyyyyy

Life formtree

Life spanperennial

Lifespan years6 years

Pollination syndromeinsect

Reproductive maturity1.5 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)3.55 mm²/mg

Wood density578 mg/cm³

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Exocarpos sparteus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGU256864.1 ↗726 bp

ACGT

GACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATT …

Exocarpos sparteus voucher Verboom1273 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type3 535 records

Wild obs. + sensor1 981

Museum / vouchered1 549

Cultivated / captive1

Other4

Origin

Native1 063

Range

Area of Occupancy AOO9 724 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 913≤1 km 329≤10 km 524>10 km 32

1 798 georeferenced · 183 without coordinates

Open the mapobservation + sensor1 981

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 331≤1 km 231≤10 km 665>10 km 170

1 397 georeferenced · 152 without coordinates

Open the institutions mapphysical evidence1 549

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	520
Kensington, AU	373
Museo Entomologico de Leonlocation not on record	166
Canberra, AU	139
Palmerston, AU	94
Brisbane, AU	77
Mount Annan, AU	27
Kew, GB	11
Hobart, AU	8
BGPAlocation not on record	7
EL PASO, US	5
Armidale, AU	4
Claremont, US	3
LDlocation not on record	3
NSW Dept of Planning, Industry and Environmentlocation not on record	3
MAlocation not on record	3
Guangzhou, CN	2
Cambridge University Herbariumlocation not on record	2
La Trobe Universitylocation not on record	2
James Cook Townsvillelocation not on record	1
University of Stellenboschlocation not on record	1
JBRJlocation not on record	1
Auckland, NZ	1
Canadian Department of Agriculturelocation not on record	1
MeiseBGlocation not on record	1
Joondalup, AU	1
Smithfield, AU	1

27 institutions · 1 457 of 1 549 vouchered records shown · 91 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Exocarpos sparteus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Exocarpos sparteus

At a glance

Sources8 archives

Size & morphology18

Life cycle & reproduction10

Diet & foraging1

Habitat & environment10

Physiology & chemistry4

At a glance

Record type3 535 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions15 of 27 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 535 records