Exocarpos aphyllus

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Santalales/Santalaceae/Exocarpos

At a glance

Occurrence records6 610

Data sources8

Biological traits43

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Exocarpos aphyllus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 610 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources43 traits

Occurrence & distributionGBIF6 610 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Exocarpos aphyllus (common name leafless ballart) belongs to the sandalwood plant family (Santalaceae).Retrieved 21 August 2019. Noongar names are chuk, chukk, dtulya and merrin. It is a species endemic to Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology13

Fruit length3 mm

Fruit width4 mm

Leaf length1 mm

Leaf length max1 mm

Leaf mass per area481 g/m2

Leaf size1 mm²

Leaf width1 mm

Plant height5 m

⚠ sources differ — GIFT: 5 m · AusTraits: 5 m · TRY: 4.67 m

Plant height max5 m

Plant height min1 m

Seed mass23.11 mg

Seed mass max22.66 mg

Seed mass min22.66 mg

Life cycle & reproduction12

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Flowering endSep

Flowering startJul

Flowering timennnnnnyyynnn

Life formtree

Life spanperennial

Lifespan years6 years

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: shrub · TRY: tree

Leaf compoundnesssimple

Leaf shapeovate

Mycorrhiza typenon-mycorrhizal

Woodinesswoody

Physiology & chemistry6

Leaf n10.69 mg/g

Leaf p1.1 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)2.99 mm²/mg

Wood density851 mg/cm³

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Exocarpos aphyllus has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHM116972.1 ↗771 bpAustralia

ACGT

GGCGGTACGCTGCCGGCGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAA …

Exocarpos aphyllus internal transcribed spacer 1, partial sequence; and 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type6 610 records

Wild obs. + sensor4 975

Museum / vouchered1 617

Cultivated / captive2

Other16

Origin

Native3 143

Range

Area of Occupancy AOO17 768 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 2 940≤1 km 897≤10 km 597>10 km 76

4 510 georeferenced · 465 without coordinates

Open the mapobservation + sensor4 975

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 549≤1 km 281≤10 km 542>10 km 96

1 468 georeferenced · 149 without coordinates

Open the institutions mapphysical evidence1 617

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	656
Kensington, AU	255
Museo Entomologico de Leonlocation not on record	115
Canberra, AU	106
Mount Annan, AU	98
Brisbane, AU	51
Armidale, AU	20
NSW Dept of Planning, Industry and Environmentlocation not on record	15
John T. Waterhouse Herbariumlocation not on record	12
Beijing, CN	8
Auckland, NZ	7
Palmerston, AU	6
Hobart, AU	6
Kew, GB	6
Christchurch, NZ	5
MeiseBGlocation not on record	4
EL PASO, US	4
BGPAlocation not on record	4
Stockholm, SE	4
Joondalup, AU	2
NSW Office of Environment and Heritagelocation not on record	2
MAlocation not on record	2
Claremont, US	2
DOI/NPS, Greenbelt Parklocation not on record	1
LDlocation not on record	1
University of Stellenboschlocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Parkville, AU	1
GB	1
Taipei, TW	1
Smithfield, AU	1

31 institutions · 1 398 of 1 617 vouchered records shown · 217 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Exocarpos aphyllus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.7 °C 26.7–26.7

Seasonal swing summer↔winter18.4 °C

Max temp (day)33.5 °C

Min temp (night)19.2 °C

Precipitation18.5 mm/mo

Air humidity39.9 %

Moisture balance-192 mm/mo

Vapour deficit2,106 Pa

Wind speed4.30 m/s

Cloud cover15.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Exocarpos aphyllus

At a glance

Sources8 archives

Size & morphology13

Life cycle & reproduction12

Diet & foraging1

Habitat & environment11

Physiology & chemistry6

At a glance

Record type6 610 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions20 of 31 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 610 records