Exobasidium japonicum

Shirai · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Exobasidiomycetes/Exobasidiales/Exobasidiaceae/Exobasidium

At a glance

Occurrence records465

Data sources9

Biological traits0

DNA specimens11

eDNA detections18

Sources9 archives

Databases and archives Exobasidium japonicum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility465 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF465 records

Environmental DNA2 datasets · 2 countries18 detections

DNA & barcodingBOLD · NCBI11 specimens

01Narrative

Die Kulturazaleen-Nacktbasidie (Exobasidium japonicum) ist eine Brandpilzart aus der Familie der Nacktbasidienverwandten (Exobasidiaceae). Sie lebt als Endoparasit auf Azaleen (Rhododendron spp.) und infiziert deren Blätter. Symptome des Befalls durch die Kulturazaleen-Nacktbasidie sind rote, stark geschwollene Blattgallen, die schließlich von Myzel überwuchert werden. Die ausgelöste Krankheit wird auch Ohrläppchenkrankheit genannt.https://www.arbofux.de/ohrlaeppchenkrankheit.html Die Art stammt aus Japan, wurde aber auch in andere Weltgegenden verschleppt.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Exobasidium japonicum has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes2

GenBank sequences10

eDNA detections18

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKY424480.1 ↗451 bp

ACGT

GCTTTCGAGCACTCCTCTATATTCTTATTCCTAAACACCTGTGAATCGTTGCTGAGCTCGCTCAGTGGCACAATCTTTTATACACACTTT …

Exobasidium japonicum voucher GLM-F105792 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type465 records

Wild obs. + sensor380

Museum / vouchered82

Cultivated / captive1

Other2

Range

Area of Occupancy AOO1 292 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy32% within 1 km

≤100 m 79≤1 km 17≤10 km 190>10 km 17

303 georeferenced · 77 without coordinates

Open the mapobservation + sensor380

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 1≤1 km 4≤10 km 17>10 km 4

26 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence82

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	15
Zürich, CH	13
Karlsruhe, DE	7
Hirosaki Universitylocation not on record	6
Uppsala, SE	4
DPIlocation not on record	4
Görlitz, DE	3
Kew, GB	2
Auckland, NZ	2
WU-MYClocation not on record	2
LDlocation not on record	2
Copenhagen, DK	2
Berlin, DE	1
Canadian Department of Agriculturelocation not on record	1
MeiseBGlocation not on record	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1
Tilburg, NL	1
Canberra, AU	1

18 institutions · 68 of 82 vouchered records shown · 6 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA18 detections

Where the DNA of Exobasidium japonicum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 7.40–17.2

Seasonal swing summer↔winter25.4 °C

Max temp (day)9.60 °C 9.60–18.0

Min temp (night)3.00 °C 3.00–16.4

Precipitation344 mm/mo 65.6–344

Air humidity64.9 % 62.5–64.9

Moisture balance263 mm/mo

Vapour deficit428 Pa 428–740

Wind speed2.90 m/s

Cloud cover44.6 % 34.6–46.4

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)