Exidia candida

Lloyd · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Tremellomycetes/Tremellales/Exidiaceae/Exidia

At a glance

Occurrence records120

Data sources6

Biological traits0

DNA specimens5

eDNA detections13

Sources6 archives

Databases and archives Exidia candida's data was compiled from.

GBIFGlobal Biodiversity Information Facility120 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF120 records

Environmental DNA3 datasets · 3 countries13 detections

DNA & barcodingBOLD · NCBI5 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Exidia candida has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes2

GenBank sequences10

eDNA detections13

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKY801872.1 ↗509 bp

ACGT

ATTAAAGATTCGGGCTTCGGCCCTACCTCTCAGCTGTGCGCTTCGGCTGCACGCTGTAACCTCTCACACCTGTGCACCTTNTCGGTCGCG …

Exidia candida var. cartilaginea voucher O F160269 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type120 records

Wild obs. + sensor39

Museum / vouchered81

Range

Area of Occupancy AOO324 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 25≤1 km 9≤10 km 1

35 georeferenced · 4 without coordinates

Open the mapobservation + sensor39

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 5≤1 km 8≤10 km 13>10 km 2

28 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence81

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	18
Helsinki, FI	17
Vancouver, CA	11
Philadelphia, US	11
Olocation not on record	5
WTUlocation not on record	4
CA	3
TENN-Flocation not on record	2
Chapel Hill, US	1
FLASlocation not on record	1
Auckland, NZ	1
Baton Rouge, US	1
Copenhagen, DK	1
WU-MYClocation not on record	1

14 institutions · 77 of 81 vouchered records shown · 4 without an institution code

09Environmental DNA13 detections

Where the DNA of Exidia candida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys3

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH5.50 4.90–6.40

Conductivity25.0 µS/cm 10.0–42.0

Organic carbon1.94 % 0.9–4.00

Nitrate-N2.00 mg/kg

Phosphorus3.00 mg/kg 2.00–13.0

Clay11.1 % 2.89–15.9

Sand82.8 % 73.5–96.1

Depth0 m 0–0.2

SoilTenosols

11 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.7 °C 12.2–14.4

Seasonal swing summer↔winter12.2 °C

Max temp (day)16.9 °C 16.4–18.4

Min temp (night)8.00 °C 7.40–9.60

Precipitation123 mm/mo 79.3–134

Air humidity59.7 % 58.5–59.7

Moisture balance38.8 mm/mo -42.9–52.6

Vapour deficit590 Pa 570–702

Wind speed2.50 m/s 2.40–3.20

Cloud cover7.60 % 7.60–32.4

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)