Excoecaria oppositifolia — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Excoecaria

At a glance

Occurrence records95

Data sources5

Biological traits10

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Excoecaria oppositifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility95 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources10 traits

Occurrence & distributionGBIF95 records

DNA & barcodingNCBIsequences

01Narrative

Excoecaria oppositifolia là một loài thực vật có hoa trong họ Đại kích. Loài này được Griff. mô tả khoa học đầu tiên năm 1844.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology1

Plant height max10 m

Life cycle & reproduction3

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Excoecaria oppositifolia has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPQ807126.1 ↗315 bpIndia · 1963

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCAATCGCAGAACGACCCGTGAACATATCATCAAA …

Excoecaria oppositifolia var. crenulata voucher L.2225837 small subunit ribosomal RNA gene and internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS4

fungal barcode

08Occurrence & distribution

Record type95 records

Wild obs. + sensor58

Museum / vouchered37

Range

Area of Occupancy AOO152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 43≤1 km 10≤10 km 4

57 georeferenced · 1 without coordinates

Open the mapobservation + sensor58

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence37

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	4
Pondicherry, IN	4
Guangzhou, CN	2
Xiamen, CN	1
Saint Louis, US	1
Edinburgh, GB	1

6 institutions · 13 of 37 vouchered records shown · 24 without an institution code