Excoecaria dallachyana

(Baill.) Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Excoecaria

At a glance

Occurrence records732

Data sources8

Biological traits35

DNA specimens2

eDNA detections1

Sources8 archives

Databases and archives Excoecaria dallachyana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility732 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources35 traits

Occurrence & distributionGBIF732 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Excoecaria dallachyana, the scrub poison tree or brush poison tree, is a species of plant in the spurge family, Euphorbiaceae It is found from the Clarence River, New South Wales to Townsville, Queensland in Australia. The habitat is rainforest by streams or in the drier form of rainforest. The leaves are toxic to livestock and the sap is irritating to human skin. It is a slender tree which may reach in height.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Fruit length8 mm

Fruit width8.5 mm

Leaf length55 mm

Leaf length max80 mm

Leaf length min30 mm

Leaf mass per area55.25 g/m2

Leaf size697 mm²

Leaf width25 mm

Leaf width max40 mm

Leaf width min10 mm

Petiole length1.5 cm

Plant height15 m

Plant height max15 m

Seed length4.5 mm

Seed width2.5 mm

Life cycle & reproduction6

Dehiscencedehiscent

Flowering timeyyyyyynnnnnn

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapelanceolate ovate

Woodinesswoody

Physiology & chemistry3

Photosynthetic pathwayC3

Specific leaf area (SLA)18.57 mm²/mg

Wood density620 mg/cm³

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Excoecaria dallachyana has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM896154.1 ↗553 bpAustralia

ACGT

AAGTGTTGGATTCAAGGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTCAATATGAAACCAAAGATACTGATATCTTGGCAGC …

Excoecaria dallachyana voucher 1076420533 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa

plant barcode

08Occurrence & distribution

Record type732 records

Wild obs. + sensor211

Museum / vouchered288

Other233

Origin

Native31

Range

Area of Occupancy AOO1 732 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 102≤1 km 12≤10 km 15>10 km 3

132 georeferenced · 79 without coordinates

Open the mapobservation + sensor211

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 79≤1 km 19≤10 km 112>10 km 45

255 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence288

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	134
Museo Entomologico de Leonlocation not on record	52
Mount Annan, AU	31
Canberra, AU	20
Smithfield, AU	18
Armidale, AU	8
Kew, GB	6
Palmerston, AU	3
James Cook Townsvillelocation not on record	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1

11 institutions · 277 of 288 vouchered records shown · 11 without an institution code

09Environmental DNA1 detections

Where the DNA of Excoecaria dallachyana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.3 °C 18.3–18.3

Seasonal swing summer↔winter10.6 °C

Max temp (day)23.0 °C

Min temp (night)14.4 °C

Precipitation132 mm/mo

Air humidity61.0 %

Moisture balance13.6 mm/mo

Vapour deficit823 Pa

Wind speed3.10 m/s

Cloud cover25.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)