Excoecaria cochinchinensis

Lour. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Excoecaria

At a glance

Occurrence records292

Data sources12

Biological traits22

DNA specimens7

eDNA detections7

Sources12 archives

Databases and archives Excoecaria cochinchinensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility292 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Chemical compositionLOTUS · NPASS18 compounds

Occurrence & distributionGBIF292 records

Environmental DNA1 datasets · 0 countries7 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB · GoaT · NCBI≈1.4 Gbp

01Narrative

红背桂花（学名：）为大戟科海漆属下的一个种。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology12

Fruit length8 mm

Fruit length max8 mm

Fruit length min8 mm

Inflorescence length max2 cm

Inflorescence length min1 cm

Leaf length100 mm

Leaf length max140 mm

Leaf length min60 mm

Leaf width26 mm

Leaf width max40 mm

Leaf width min12 mm

Plant height1 m

⚠ sources differ — GIFT: 1 m · TRY: 1.5 m

Life cycle & reproduction3

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition18 compounds

Compounds documented for Excoecaria cochinchinensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Corynanthe type3

Flavonols3

Labdane diterpenoids3

Daphnane diterpenoids1

Apocarotenoids(ε-) $ Megastigmanes1

Documented compounds18 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,5S)-2,6,6-trimethyl-10-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]-1-oxaspiro[4.5]deca-3,9-dien-8-one	present	LOTUS
(4R)-4-[(3S)-3-hydroxybutyl]-5,5-dimethyl-3-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]cyclohex-2-en-1-one	present	LOTUS
(6S,7aS)-5,6,7,7a-Tetrahydro-6-hydroxy-4,4,7a-trimethyl-2(4H)-benzofuranone	present	LOTUS
4-Hydroxybenzoic acid	present	LOTUS
[(3R,4aR,5S,6S,6aS,10S,10aR,10bS)-6-acetyloxy-3-ethenyl-5,10b-dihydroxy-3,4a,7,7,10a-pentamethyl-1-oxo-5,6,6a,8,9,10-hexahydro-2H-benzo[f]chromen-10-yl] acetate	present	LOTUS
[(3R,4aR,6S,6aS,8R,9S,10aS,10bS)-8-acetyloxy-3-ethenyl-6,10b-dihydroxy-3,4a,7,7,10a-pentamethyl-1-oxo-5,6,6a,8,9,10-hexahydro-2H-benzo[f]chromen-9-yl] acetate	present	LOTUS
Afzelin	present	LOTUS
Astragalin	present	LOTUS
Corynantheine	present	NPASS
Dihydrocorynantheine	present	NPASS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Excoecaria cochinchinensis has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes3

GenBank sequences10

eDNA detections7

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPQ807125.1 ↗315 bpTaiwan · 1980

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCAATAGCAGAACGACCCGTGAACATATCATCGAA …

Excoecaria cochinchinensis var. viridis voucher L.2225896 small subunit ribosomal RNA gene and internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★ITS9

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Excoecaria cochinchinensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 398 323 618 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Excoecaria cochinchinensis1.4 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Chromosome records22–222n range22median22mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 224×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-indian_vol1 +1

CCDB · ipcn-api-dl

CCDB · book-ipcn67-71 — DATTA, N. 1967. In IOPB chromosome number reports XII. Taxon 16: 341-350-:-

CCDB · book-indian_vol1 — Sharma, A.K. & Jash, M. 1958c ; Datta, N. 1967 ; Kothari, N.M. et al. 1980

CCDB · eflora

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type292 records

Wild obs. + sensor210

Museum / vouchered81

Cultivated / captive1

Origin

Introduced1

Range

Area of Occupancy AOO856 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 128≤1 km 13≤10 km 7>10 km 1

149 georeferenced · 61 without coordinates

Open the mapobservation + sensor210

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 79 without coordinates

Open the institutions mapphysical evidence81

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	14
Beijing, CN	8
Guangzhou, CN	7
Guilin, CN	6
Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record	4
Nanjing, CN	4
Jinghong, CN	3
Saint Louis, US	3
University of Stellenboschlocation not on record	2
Bronx, US	2
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	2
Chengdu, CN	2
Edinburgh, GB	2
Moscow State Universitylocation not on record	2
Chengdu, CN	2
CASlocation not on record	2
Vancouver, CA	1
Christchurch, NZ	1
Miami, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Kunming, CN	1
Taipei, TW	1
Kagoshima, JP	1
Wuhan, CN	1
Berlin, DE	1
Guangxi Agricultural Universitylocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Yunnan Universitylocation not on record	1
St. Augustine, TT	1

29 institutions · 78 of 81 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Excoecaria cochinchinensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)