Exacum affine

Balf.fil. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Gentianaceae/Exacum

At a glance

Occurrence records69

Data sources11

Biological traits8

DNA specimens12

eDNA detections9

Sources11 archives

Databases and archives Exacum affine's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility69 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Chemical compositionLOTUS6 compounds

Occurrence & distributionGBIF69 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD · NCBI12 specimens

Genome at a glanceCCDB2n = 36

01Narrative

Exacum affine, la Violette de Perse, est une espèce de plantes à fleurs de la famille des gentianacées. C'est une petite plante ornementale originaire d'Asie.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.03 mg

Seed mass max0.03 mg

Seed mass min0.03 mg

Life cycle & reproduction1

Life formannual

Habitat & environment3

Climatedesert or dry shrubland

Growth form detailedherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition6 compounds

Compounds documented for Exacum affine across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Acyl phloroglucinols2

Iridoids monoterpenoids2

Secoiridoid monoterpenoids1

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
Affinoside	present	LOTUS
Gentiopicroside	present	LOTUS
methyl (1S,4aS,6S,7R,7aS)-1-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(E)-3-(4-hydroxyphenyl)prop-2-enoyl]oxyoxan-2-yl]oxy-6-hydroxy-7-methyl-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-4-carboxylate	present	LOTUS
Paeonol	present	LOTUS
Paeonoside	present	LOTUS

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Exacum affine has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes5

GenBank sequences10

eDNA detections9

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOL536483.1 ↗361 bpUSA · 2018

ACGT

TGCAGAATCCCGTGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGAATC …

Exacum affine voucher MO:Carlsen3340 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★ITS4★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Exacum affine carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome records36–362n range36median36mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 362×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Sugiura 1936a,b

CCDB · book-atlas-flowering-plants — Sugiura 1936

n 181×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — POST, D. M. 1967. In Documented chromosome numbers of plants. Madrano 19: 134-136:-

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type69 records

Wild obs. + sensor51

Museum / vouchered17

Cultivated / captive1

Range

Area of Occupancy AOO148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 34≤1 km 2≤10 km 1>10 km 1

38 georeferenced · 13 without coordinates

Open the mapobservation + sensor51

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 2≤1 km 2≤10 km 2

6 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence17

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uppsala, SE	3
Mexico City, MX	2
St. Augustine, TT	2
Wuzhou, CN	1
Moscow State Universitylocation not on record	1
Berlin, DE	1
DOI/NPS, Greenbelt Parklocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
ASUlocation not on record	1

9 institutions · 13 of 17 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA9 detections

Where the DNA of Exacum affine was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 9.80–26.6

Seasonal swing summer↔winter21.4 °C

Max temp (day)23.9 °C 15.1–32.7

Min temp (night)12.7 °C 6.00–19.3

Precipitation54.5 mm/mo 13.6–95.4

Air humidity51.3 % 46.2–56.4

Moisture balance-69.1 mm/mo -172–33.5

Vapour deficit1,379 Pa 635–2,123

Wind speed4.00 m/s 3.90–4.20

Cloud cover29.5 % 14.2–44.9

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)