Evolvulus alsinoides
(L.) L. · speciesAt a glance
Occurrence records15 392
Data sources11
Biological traits45
DNA specimens58
eDNA detections30
Sources11 archives
Databases and archives Evolvulus alsinoides's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility15 392 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics58 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources45 traits
Chemical compositionLOTUS · NPASS28 compounds
Occurrence & distributionGBIF15 392 records
Environmental DNA1 datasets · 4 countries30 detections
DNA & barcodingBOLD · NCBI58 specimens
Genome at a glanceCCDB2n = 26
01Narrative
Evolvulus alsinoides est une espèce de plantes dicotylédones de la famille des Convolvulaceae, à répartition pantropicale, probablement d'origine américaine. C'est une plante herbacée, annuelle ou vivace, aux tiges élancées plus ou moins ramifiées, à fleurs bleues. La plante entière a des applications médicinales chez différents peuples des régions tropicales, notamment en Inde où elle est connue sous le nom de Vishnukrantha et participe à la médecine ayurvédique.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology17
Fruit length3.5 mm
⚠ sources differ — AusTraits: 3.5 mm · GIFT: 3.75 mm
Fruit length max4 mm
Fruit length min3.5 mm
Fruit width3.5 mm
Leaf length17.5 mm
⚠ sources differ — AusTraits: 17.5 mm · GIFT: 9.33 mm
Leaf length max30 mm
Leaf length min3 mm
Leaf size410 mm²
Leaf width3.5 mm
⚠ sources differ — AusTraits: 3.5 mm · GIFT: 5 mm
Leaf width max10 mm
Leaf width min2 mm
Plant height0.3 m
⚠ sources differ — GIFT: 0.3 m · AusTraits: 0.475 m · TRY: 0.45 m
Plant height max0.6 m
Plant height min0 m
Seed mass0.813 mg
⚠ sources differ — TRY: 0.813 mg · AusTraits: 0.836 mg · GIFT: 0.785 mg
Seed mass max1.5 mg
Seed mass min0.25 mg
Life cycle & reproduction10
Deciduousnessevergreen
Dehiscencedehiscent
Dispersal typeself
⚠ sources differ — AusTraits: barochory · GIFT: unspecialized
Flowering timennnnnnnnnnnn
Life formannual or perennial
Life spanperennial
Pollination syndromeinsect
Raunkiær life formchamaephyte
Resprouting capacityresprouts
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation max1 800 m
Elevation mean1 172 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Habitat GIFTCampo Limpo
Leaf compoundnesssimple
Leaf shapelinear
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
03Chemical composition28 compounds
Compounds documented for Evolvulus alsinoides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavonols16
Cinnamic acids and derivatives5
Fatty alcohols3
Flavones2
Simple coumarins2
Documented compounds28 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R,3aR,5aR,5bR,7aS,9S,11aS,11bR,13aR,13bR)-3a,5a,5b,8,8,9,11a-heptamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene | present | LOTUS | |
| (2E,6E)-1-Hydroxy-2,6,10-farnesatrien-9-one | present | NPASS | |
| (2R,3R)-2-methylbutane-1,2,3,4-tetrol | present | LOTUS | |
| 1-Hexanol | present | LOTUS | |
| 2-[4-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxyphenyl]-3,5,7-trihydroxychromen-4-one | present | LOTUS | |
| 2-Methylnonacosane | present | NPASS | |
| 3-(3,4-Dihydroxyphenyl)Prop-2-Enoic Acid | present | LOTUS | |
| 4-Methyl-1-((2R,5S)-2,3,4,5-tetrahydro-5-methyl(2,3'-bifuran)-5-yl)-2-pentanone | present | NPASS | |
| Astragalin | present | LOTUS | |
| beta-Carotene | present | NPASS |
05DNA & barcoding58 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Evolvulus alsinoides has left across the world's sequence archives.
At a glance
DNA specimens58
Marker genes8
GenBank sequences10
eDNA detections30
Countries6
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAACCGTCAGGTCTAGGGCACGTCTGCCTGGGTGTCACGCATC …
Evolvulus alsinoides isolate M79 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL7★rbcLa★trnL-F★ITS2★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Evolvulus alsinoides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 26 n = 13
Ploidydiploid inferred
Chromosome records22–262n range26median26mode6records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 265×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · eflora +1
CCDB · ipcn-api-dl — Bir, S. S., S. Kumari, S. P. Shoree & M. S. Sagoo. 1978. Cytological studies in certain Bicarpellatae from north and central India. J. Cytol. Genet. 13: 99–106.
CCDB · ipcn-api-dl — Bir, S. S., S. Kumari, S. P. Shoree & M. S. Sagoo. 1978a. Cytological studies in certain Bicarpeilatse from north and central India. J. Cytol. Genet. 13: 99–106.
CCDB · book-indian_vol1 — Raghavan, R.S. 1959b; Mehra, P.N. & Vasudevan, K.N. 1972; Vij, S.P. et al. 1973, 1977
CCDB · eflora
CCDB · book-fedorov — Raghavan R. S. 1959b
2n 221×CCDB · book-indian_vol1
CCDB · book-indian_vol1 — Bir, S.S., Kumari, S. et al. 1978
n 132×CCDB · ipcn-api-dl · CCDB · book-ipcn72
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
CCDB · book-ipcn72 — MEHRA, P.N . & K.N. VASUDEVAN. 1972. In IOPB chromosome number reports XXXVI. Taxon 21: 333-346.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type15 392 records
Wild obs. + sensor8 766
Museum / vouchered5 588
Other1 038
Origin
Native120
Range
Area of Occupancy AOO40 152 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy90% within 1 km
≤100 m 4 502≤1 km 652≤10 km 306>10 km 288
5 748 georeferenced · 3 018 without coordinates
Open the mapobservation + sensor8 766
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy66% within 1 km
≤100 m 1 220≤1 km 267≤10 km 614>10 km 140
2 241 georeferenced · 3 347 without coordinates
Open the institutions mapphysical evidence5 588
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions134 of 251 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Durango, MX | 370 |
| Saint Louis, US | 368 |
| Pretoria, ZA | 329 |
| Mexico City, MX | 263 |
| Palmerston, AU | 258 |
| Brisbane, AU | 254 |
| Austin, US | 243 |
| Paris, FR | 145 |
| Kew, GB | 133 |
| Canberra, AU | 126 |
| Baroda, IN | 118 |
| Anchorage, US | 101 |
| Miami, US | 95 |
| QAUlocation not on record | 92 |
| Bronx, US | 88 |
| San Diego, US | 85 |
| Beijing, CN | 79 |
| Juriquilla, MX | 71 |
| Taipei, TW | 69 |
| ASUlocation not on record | 69 |
| HNBlocation not on record | 66 |
| Museo Entomologico de Leonlocation not on record | 65 |
| National Biodiversity Institute, Costa Ricalocation not on record | 61 |
| Guangzhou, CN | 54 |
| Austin, US | 48 |
| MeiseBGlocation not on record | 45 |
| Riverside, US | 45 |
| Ciudad de México, MX | 43 |
| Mexico City, MX | 41 |
| Smithfield, AU | 39 |
| Guasave, MX | 37 |
| University of Stellenboschlocation not on record | 37 |
| Kunming, CN | 36 |
| National Museum of Natural Sciencelocation not on record | 36 |
| Nanjing, CN | 33 |
| Mérida, MX | 32 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 31 |
| Culiacán, MX | 29 |
| Chapingo, MX | 28 |
| Frankfurt am Main | 27 |
| Antiguo Cuscatlán, SV | 26 |
| Giardini Botanici Hanburylocation not on record | 25 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 25 |
| Kensington, AU | 23 |
| Adam Mickiewicz University in Poznańlocation not on record | 23 |
| Berlin, DE | 23 |
| Phoenix, US | 23 |
| Pondicherry, IN | 22 |
| Durban, ZA | 22 |
| Chicago, US | 21 |
| Taipei, TW | 20 |
| Guilin, CN | 20 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 19 |
| Zacatecas, MX | 19 |
| Hermosillo, MX | 19 |
| Mount Annan, AU | 19 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 19 |
| EL PASO, US | 19 |
| Plocation not on record | 18 |
| San José, CR | 15 |
| TAIElocation not on record | 15 |
| Tapachula, MX | 14 |
| Tampa, US | 14 |
| Xiamen, CN | 14 |
| WAGlocation not on record | 13 |
| León, NI | 13 |
| Yaoundé, CM | 12 |
| Université du Lomélocation not on record | 12 |
| Taipei, TW | 12 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 12 |
| Wuhan, CN | 11 |
| Armidale, AU | 10 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 10 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 10 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 9 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 9 |
| Area de Conservacion Guanacastelocation not on record | 9 |
| Hobart, AU | 9 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 9 |
| La Paz, MX | 9 |
| Autlán de Navarro, MX | 9 |
| Instituto de Ecología, Universidad Nacional Autónoma de Méxicolocation not on record | 9 |
| Toluca, MX | 9 |
| Universidad Nacional de Colombia (UNAL)location not on record | 9 |
| Wuhan, CN | 8 |
| Uppsala, SE | 8 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 8 |
| MEXUlocation not on record | 7 |
| Dehra Dun, IN | 7 |
| Odawara, JP | 7 |
| Santa Cruz de la Sierra, BO | 7 |
| Altos de Pipe, VE | 7 |
| Flagstaff, US | 7 |
| TAFORI-LSRClocation not on record | 6 |
| San Angelo, US | 6 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 6 |
| Jena Microbial Resource Collectionlocation not on record | 6 |
| Hangzhou, CN | 6 |
| Tuxtla Gutiérrez, MX | 6 |
| Conservatoire Botanique National de Mascarinlocation not on record | 6 |
| Adelaide, AU | 6 |
| Universidad Nacional de Asunciónlocation not on record | 6 |
| Glocation not on record | 6 |
| Fort Worth, US | 6 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 6 |
| Smithsonian Institution, National Museum of Natural History, United States National Herbariumlocation not on record | 5 |
| Paleontological Collectionlocation not on record | 5 |
| The University of Arizonalocation not on record | 5 |
| Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record | 5 |
| Cape Town, ZA | 4 |
| Edinburgh, GB | 4 |
| Zürich, CH | 4 |
| Museu Paraense Emílio Goeldilocation not on record | 4 |
| South Kensington, GB | 4 |
| EFGlocation not on record | 4 |
| Moscow State Universitylocation not on record | 4 |
| Albuquerque, US | 4 |
| Mérida, MX | 4 |
| Chongqing Museumlocation not on record | 4 |
| CNF-UFHBlocation not on record | 4 |
| Chengdu, CN | 4 |
| Claremont, US | 4 |
| Instituto de Investigação Científica Tropicallocation not on record | 4 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 4 |
| Bangkok, TH | 4 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 4 |
| Fundación Desarrollo y Ambiente FUNDAlocation not on record | 4 |
| FJIDClocation not on record | 3 |
| La Paz, BO | 3 |
| Managua, NI | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| DOI/NPS, Greenbelt Parklocation not on record | 3 |
| Cambridge, US | 3 |
| Auckland, NZ | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| Wuzhou, CN | 3 |
| Museum of Zoologylocation not on record | 3 |
| Zhejiang Universitylocation not on record | 3 |
| Lubbock, US | 3 |
| Guangzhou, CN | 3 |
| Chengdu, CN | 3 |
| Tuscaloosa, US | 3 |
| Nanjing, CN | 3 |
| Fujian Institute of Subtropical Botanylocation not on record | 3 |
| John T. Waterhouse Herbariumlocation not on record | 3 |
| CJBGlocation not on record | 3 |
| MAlocation not on record | 3 |
| Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record | 2 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 2 |
| Montecillo, Texcoco, MX | 2 |
| HACAMlocation not on record | 2 |
| Mexico City, MX | 2 |
| Stockholm, SE | 2 |
| Valdosta State Universitylocation not on record | 2 |
| JBRJlocation not on record | 2 |
| Linares, MX | 2 |
| Forest Herbarium Ibadan (FHI)location not on record | 2 |
| Laboratorio de Ictiologialocation not on record | 2 |
| Teresina, BR | 2 |
| Ensenada, MX | 2 |
| San Luis Obispo, US | 2 |
| Haramaya Universitylocation not on record | 2 |
| Gujarat Biodiversity Gene Banklocation not on record | 2 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 2 |
| Davis, US | 2 |
| Burlington, US | 2 |
| SCAUlocation not on record | 2 |
| Llocation not on record | 2 |
| Elocation not on record | 2 |
| University of Oxfordlocation not on record | 2 |
| Cochabamba, BO | 2 |
| IEBlocation not on record | 2 |
| Puebla, MX | 2 |
| University of Johannesburglocation not on record | 2 |
| Guatemala City, GT | 2 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 2 |
| McWane Science Centerlocation not on record | 2 |
| GMBAlocation not on record | 1 |
| USP-IBlocation not on record | 1 |
| Campo Mourão, BR | 1 |
| Mississippi State, US | 1 |
| Changsha, CN | 1 |
| Denton, US | 1 |
| Chongqing Natural History Museumlocation not on record | 1 |
| Kagoshima, JP | 1 |
| Mlocation not on record | 1 |
| Corrientes, AR | 1 |
| LGlocation not on record | 1 |
| EAlocation not on record | 1 |
| Clocation not on record | 1 |
| Forestry Research Institute of Nigerialocation not on record | 1 |
| Boise, US | 1 |
| National Natural History Collectionslocation not on record | 1 |
| Eduardo Mondlane Universitylocation not on record | 1 |
| LISClocation not on record | 1 |
| San Francisco, US | 1 |
| Florida Atlantic Universitylocation not on record | 1 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 1 |
| University of Hamburglocation not on record | 1 |
| Njala Universitylocation not on record | 1 |
| Centre National de Semences Forestièreslocation not on record | 1 |
| Honolulu, US | 1 |
| Guiyang, CN | 1 |
| Centre National des Semences Forestièreslocation not on record | 1 |
| Shenzhen, CN | 1 |
| Cincinnati, US | 1 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 1 |
| BAYLUlocation not on record | 1 |
| Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record | 1 |
| Emporia, US | 1 |
| Cenargenlocation not on record | 1 |
| UJLOGlocation not on record | 1 |
| UNIVASFlocation not on record | 1 |
| LDlocation not on record | 1 |
| Conservatoire Botanique National de Mascarinlocation not on record | 1 |
| Salamanca, ES | 1 |
| Sucre, BO | 1 |
| Universidade de Santa Cruz do Sullocation not on record | 1 |
| CASlocation not on record | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| Philadelphia, US | 1 |
| Shanghai, CN | 1 |
| UFMGlocation not on record | 1 |
| Ilhéus, BR | 1 |
| Monastir, TN | 1 |
| St. Augustine, TT | 1 |
| University of Zhejianglocation not on record | 1 |
| IPA/SPlocation not on record | 1 |
| Pullman, US | 1 |
| Yangling, CN | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| Porto Alegre, BR | 1 |
| MSB-3054location not on record | 1 |
| Awka, NG | 1 |
| NO DISPONIBLElocation not on record | 1 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 1 |
| BISHlocation not on record | 1 |
| Jackson, US | 1 |
| Vancouver, CA | 1 |
| OTSlocation not on record | 1 |
| Morelia, MX | 1 |
| Mazatlán, MX | 1 |
| University of Alberta Museumslocation not on record | 1 |
| UEPAlocation not on record | 1 |
| Tlalnepantla, MX | 1 |
| Trondheim, NO | 1 |
| Tempe, US | 1 |
| Mexico City, MX | 1 |
| UnBlocation not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| Brasília, BR | 1 |
251 institutions · 5 295 of 5 588 vouchered records shown · 293 without an institution code
09Environmental DNA30 detections
Where the DNA of Evolvulus alsinoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found30
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 30 detections have coordinates
Open the map4 countries0
UHURU North Plots; Savanna bushland in red s…UHURU North Plots
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median23.7 °C 19.2–25.7
Seasonal swing summer↔winter2.60 °C
Max temp (day)26.2 °C 24.9–30.3
Min temp (night)21.1 °C 13.4–23.4
Precipitation109 mm/mo 29.3–160
Air humidity59.5 % 55.6–68.0
Moisture balance-49.8 mm/mo -87.6–26.3
Vapour deficit995 Pa 939–1,484
Wind speed2.90 m/s 2.00–4.00
Cloud cover31.2 % 11.4–36.6
CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.