Everistia vacciniifolia

(F.Muell.) S.T.Reynolds & R.J.F.Hend. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Everistia

At a glance

Occurrence records387

Data sources8

Biological traits27

DNA specimens3

eDNA detections2

Sources8 archives

Databases and archives Everistia vacciniifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility387 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources27 traits

Occurrence & distributionGBIF387 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Everistia is a genus of the flowering plant family Rubiaceae. The sole species Everistia vacciniifolia grows naturally only (endemic) from north eastern New South Wales through to north eastern Queensland, Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology8

Fruit length5.5 mm

Fruit width5.5 mm

Leaf length10.25 mm

Leaf mass per area66.08 g/m2

Leaf size67.97 mm²

⚠ sources differ — TRY: 67.97 mm² · AusTraits: 76.38 mm²

Leaf width6.75 mm

Petiole length0.125 cm

Plant height8 m

⚠ sources differ — GIFT: 8 m · AusTraits: 7 m

Life cycle & reproduction5

Deciduousnessevergreen

Flowering timeyyyynnnnnnny

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree

Leaf compoundnesssimple

Leaf shapeelliptical obovate orbicular

Woodinesswoody

Physiology & chemistry2

Specific leaf area (SLA)15.65 mm²/mg

Wood density680 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Everistia vacciniifolia has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM896146.1 ↗512 bpAustralia

ACGT

CTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCGGGAGTTCCACCTGAAGAAG …

Everistia vacciniifolia voucher 1076419066 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa

plant barcode

08Occurrence & distribution

Record type387 records

Wild obs. + sensor139

Museum / vouchered58

Other190

Origin

Native3

Range

Area of Occupancy AOO1 200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 60≤1 km 18≤10 km 6>10 km 12

96 georeferenced · 43 without coordinates

Open the mapobservation + sensor139

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 10≤1 km 4≤10 km 22>10 km 1

37 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence58

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	17
Canberra, AU	8
Armidale, AU	8
Smithfield, AU	7
James Cook Townsvillelocation not on record	6
Mount Annan, AU	2
John T. Waterhouse Herbariumlocation not on record	2
Museo Entomologico de Leonlocation not on record	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	2
IPA/SPlocation not on record	1
Palmerston, AU	1

11 institutions · 56 of 58 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Everistia vacciniifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 17.3–19.5

Seasonal swing summer↔winter11.7 °C

Max temp (day)24.0 °C 22.9–25.2

Min temp (night)13.6 °C 12.5–14.6

Precipitation65.6 mm/mo 60.4–70.8

Air humidity57.5 % 56.6–58.5

Moisture balance-56.3 mm/mo -62.5–-50.1

Vapour deficit925 Pa 840–1,010

Wind speed3.30 m/s 3.00–3.60

Cloud cover25.1 % 24.7–25.5

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)