Euxoa septentrionalis

Walker, 1865 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records386

Data sources7

Biological traits0

DNA specimens37

eDNA detections35

Sources7 archives

Databases and archives Euxoa septentrionalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility386 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics37 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF386 records

Environmental DNA1 datasets · 2 countries35 detections

DNA & barcodingBOLD37 specimens

01Narrative

Euxoa septentrionalis is a species of cutworm or dart moth in the family Noctuidae. It is found in North America. The MONA or Hodges number for Euxoa septentrionalis is 10739.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding37 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa septentrionalis has left across the world's sequence archives.

At a glance

DNA specimens37

BINs3

Marker genes1

eDNA detections35

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus37 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

85Gmostly conserved

106Cvariable

364Cmostly conserved

373Gmostly conserved

415Gmostly conserved

596Cmostly conserved

616Tmostly conserved

619Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACTTCCTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCGGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.41%

Haplotypes9

BINs3

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa vallussame genus2.9%Euxoa auxiliarissame genus2.9%Euxoa bifasciatasame genus3.2%Euxoa anticasame genus3.3%Euxoa dodisame genus3.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type386 records

Wild obs. + sensor17

Museum / vouchered369

Range

Area of Occupancy AOO548 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 4≤1 km 3≤10 km 5

12 georeferenced · 5 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 58≤1 km 43≤10 km 50>10 km 32

183 georeferenced · 186 without coordinates

Open the institutions mapphysical evidence369

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	90
Oregon State Arthropod Collectionlocation not on record	49
New Haven, US	43
Vernal, US	43
University of Alberta Museums (UAM)location not on record	37
St. Paul, US	26
Santa Cruz, US	20
Colorado State Universitylocation not on record	14
Helsinki, FI	13
Essig Museum of Entomologylocation not on record	13
National Institute of Biological Resourceslocation not on record	3
WWUlocation not on record	2
Denver, US	1
San Francisco, US	1
East Lansing, US	1

15 institutions · 356 of 369 vouchered records shown · 13 without an institution code

09Environmental DNA35 detections

Where the DNA of Euxoa septentrionalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found35

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 35 detections have coordinates

Open the map2 countries0

1. Forest & Woodland4. Native Grassland | 4.4. Temperate GrasslandUplandMarsh

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 12.0–21.0

Seasonal swing summer↔winter14.9 °C

Max temp (day)20.9 °C 17.8–28.9

Min temp (night)13.3 °C 4.70–17.0

Precipitation16.8 mm/mo 1.90–45.4

Air humidity53.8 % 48.0–66.3

Moisture balance-89.2 mm/mo

Vapour deficit772 Pa 649–1,233

Wind speed2.80 m/s

Cloud cover21.1 % 11.9–41.6

CHELSA 1981–2010, ~9 km grid, at location & month of 34 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)