Euxoa scandens

Riley, 1869 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records444

Data sources7

Biological traits0

DNA specimens12

eDNA detections11

Sources7 archives

Databases and archives Euxoa scandens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility444 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF444 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD12 specimens

01Narrative

Euxoa scandens, the white cutworm, is a species of cutworm or dart moth in the family Noctuidae. It is found in North America. The MONA or Hodges number for Euxoa scandens is 10715.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa scandens has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections11

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.16%

Haplotypes1

BIN1

Where individuals differ — all 2 variable positions, in barcode order

217Gvariable

268Tvariable

AACATTATATTTTATTTTCGGTATTTGAGCAGGAATAATTGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa quebecensissame genus1.8%Euxoa simonasame genus2.3%Euxoa pleuriticasame genus2.6%Euxoa bivittatasame genus2.6%Euxoa edictalissame genus2.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type444 records

Wild obs. + sensor68

Museum / vouchered376

Range

Area of Occupancy AOO748 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 38≤1 km 9≤10 km 2>10 km 10

59 georeferenced · 9 without coordinates

Open the mapobservation + sensor68

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 4≤1 km 37≤10 km 85>10 km 5

131 georeferenced · 245 without coordinates

Open the institutions mapphysical evidence376

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	112
East Lansing, US	106
University of Alberta Museums (UAM)location not on record	61
Royal Saskatchewan Museumlocation not on record	22
Helsinki, FI	18
New Haven, US	15
Colorado State Universitylocation not on record	14
ASUlocation not on record	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Vernal, US	2
OSUClocation not on record	2
UDlocation not on record	2
Brussels, BE	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
Washington, US	2
Denver, US	1
Decorah, US	1
Oregon State Arthropod Collectionlocation not on record	1
RBINS-Scientific Heritagelocation not on record	1
UNHClocation not on record	1

20 institutions · 370 of 376 vouchered records shown · 6 without an institution code

09Environmental DNA11 detections

Where the DNA of Euxoa scandens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

Temperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.1 °C 6.80–20.1

Seasonal swing summer↔winter26.1 °C

Max temp (day)18.9 °C 12.2–25.6

Min temp (night)15.0 °C 1.80–17.5

Precipitation96.6 mm/mo 67.6–109

Air humidity59.8 % 53.4–74.6

Moisture balance-11.0 mm/mo

Vapour deficit608 Pa 448–1,046

Wind speed5.80 m/s

Cloud cover39.7 % 36.6–47.9

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)