Euxoa perpolita

Morrison, 1876 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records267

Data sources6

Biological traits0

DNA specimens7

eDNA detections0

Sources6 archives

Databases and archives Euxoa perpolita's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility267 records↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF267 records

DNA & barcodingBOLD7 specimens

01Narrative

Euxoa perpolita, the polished dart, is a species of cutworm or dart moth in the family Noctuidae. It is found in North America. The MONA or Hodges number for Euxoa perpolita is 10865.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa perpolita has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAATTGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa aberranssame genus1.5%Euxoa wilsonisame genus1.7%Euxoa maimessame genus1.7%Euxoa nomassame genus1.7%Euxoa flavicollissame genus1.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type267 records

Wild obs. + sensor51

Museum / vouchered216

Range

Area of Occupancy AOO400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 21≤1 km 7≤10 km 7>10 km 1

36 georeferenced · 15 without coordinates

Open the mapobservation + sensor51

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 12≤1 km 78≤10 km 29>10 km 9

128 georeferenced · 88 without coordinates

Open the institutions mapphysical evidence216

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	61
Colorado State Universitylocation not on record	61
East Lansing, US	52
New Haven, US	14
Natural History Museum of Utahlocation not on record	6
Royal Saskatchewan Museumlocation not on record	4
St. Paul, US	3
Toronto, CA	3
UDlocation not on record	2
Helsinki, FI	1
Oregon State Arthropod Collectionlocation not on record	1
Brussels, BE	1
RBINS-Scientific Heritagelocation not on record	1
UNHClocation not on record	1

14 institutions · 211 of 216 vouchered records shown · 5 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)