Euxoa pallipennis

Smith · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Euxoa

At a glance

Occurrence records261

Data sources7

Biological traits0

DNA specimens5

eDNA detections7

Sources7 archives

Databases and archives Euxoa pallipennis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility261 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF261 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD5 specimens

01Narrative

Euxoa pallipennis is a species of cutworm or dart moth in the family Noctuidae. It is found in North America. The MONA or Hodges number for Euxoa pallipennis is 10765.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euxoa pallipennis has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACTTCTCTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euxoa atristrigatasame genus2.1%Euxoa aequalissame genus2.7%Euxoa velleripennissame genus2.7%Euxoa franclemontisame genus2.7%Euxoa zernyisame genus2.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type261 records

Wild obs. + sensor10

Museum / vouchered251

Range

Area of Occupancy AOO284 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 2≤1 km 2≤10 km 4>10 km 2

10 georeferenced

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 10≤10 km 6>10 km 4

20 georeferenced · 231 without coordinates

Open the institutions mapphysical evidence251

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	72
St. Paul, US	69
Vernal, US	58
Oregon State Arthropod Collectionlocation not on record	23
Colorado State Universitylocation not on record	10
Natural History Museum of Utahlocation not on record	4
WWUlocation not on record	3
New Haven, US	2
East Lansing, US	2
Denver, US	1
Albuquerque, US	1
Royal Saskatchewan Museumlocation not on record	1

12 institutions · 246 of 251 vouchered records shown · 5 without an institution code

09Environmental DNA7 detections

Where the DNA of Euxoa pallipennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.1 °C 15.9–23.6

Seasonal swing summer↔winter22.4 °C

Max temp (day)29.1 °C 24.4–30.2

Min temp (night)14.1 °C 8.50–17.0

Precipitation15.3 mm/mo 10.9–35.2

Air humidity47.2 % 41.9–47.9

Moisture balance-89.9 mm/mo -144–-86.7

Vapour deficit1,469 Pa 942–1,678

Wind speed2.60 m/s 2.50–3.00

Cloud cover19.6 % 18.2–37.0

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)